Loxodonta_africana Locus Poly:25:SNORD115
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Poly:25:SNORD115
Loxodonta_africana
Poly:25:SNORD115
scaffold_112361
SNORD115, SNORD115, SNORD115
1001..1081, 2700..2776, 4409..4490
4814
TTCTGTCAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGTGTCTTGATTTCGTCCC
TCTTTTGGGCTATATGTGGAAAAAGCATAGCTGTTAGGCAATGAATGTCTCTCGTCTGAT
GTCTGACTTACTTCTTTGCCCTTCCTCAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTGC
TTTCATGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGGATGTGCGAACCTTCTCATC
CTGCGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGGAACTTGAAGACTCAGGTGA
TTTCTCCCGGGGATTGAGATGTCTCGGGTCAACGAAGACACCTCAACTTGTCTCGAAGAG
AGATGATGACATAAAAATCATGCTCAATAGGATCCCGCTGAGGCCCAGAGAGAAACTCCT
TTTCCCTAACGTTAATGATCTGCTTTAGAGGGGACCCCCATTTGGATCCCTTTTTCCTCC
ACCAAGTGATCAAAAACTCCTCCCTGACCGATTGTGGTCATGCTGATTCCTTGGCTCTTT
TCGTCTTTTTCTGTCATTTCGAAAGACCTGCTTTCAGGAGATTCACCACCGAAAGAACTC
AAGGTGAGTGAATGACGGCGGTTTTCCCTTGTCTCTGGTGACACTTAGACAAGTGAAAAT
GGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCT
TGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTGGATAGTTAGGAAGCACAG
GAACCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCTGGTTCCCAGTCGGGTATGT
CTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACGGGATGGGAGTGTGTAGCA
GCTCTACTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGCCTGTGTCAGTTGCGACTG
GACTCTTAGGATCTCCAGGGCCTCTTTCCCAGACATCTTGGTATTGGATGAAGACTGGAG
TAGCCTGACACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCACTATCTGAGTCAAA
AAGCTAATGCCAGGCTCAATACCATTCGGTACGTGGGTCGCGAGCGTCATGACTAGTTTC
AGGTTCATACCACAGGAGGTCAGGATCTGCTGACAGTCTAATCAGGCAATGCAGGCATAA
CTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAG
ATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATATACGGGA
GGAGATGTGTTCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTC
CATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGC
AGAATTCTTGGAAAGCTATTCTTTTCCAAATGTCCTCCAGCTGATTTGAAGATCCCCCGG
TGCTGGTGACTCTTGGGTGCCATTTCCCGGGAGTCCGCACACATTGGACAGTGCCCGTGG
ACGCATAGTTGGCTGCCTTCAACACATCAGTCAGGCTTAAGCAATGGCAAAGGCTCCTTT
TGCCTGGGTCCTCCTGTAAATTTGTGCTACATCCAGAGACCTCTCTGCCTTCTTCTGAAT
ATTGCATGATTCTCTCCTGCTGTCATGGGTCAGCAGACTCCCCAGTGGGTTGCAAATGGC
TGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCCTAGCCTTAGGGAAGT
GAGTTTCTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTTTTCAAAGGGTTAGTGAGGT
CGATGTCTCTTGTGCCGCTTTCATGGGGGTCAAGCCAACTGCCCGGGAAACTGGAAGATG
ATGTGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGC
ATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCATGATGACATA
ATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTGATGCTGAGGCC
CTGTGAGAGAGTCCTTTGACCAGCCTTCCAGATCTTCTTAGAGCGACTCCATTTGATTCT
TCACTGCACCAAGTAATCTAAGACTGGTGGCGATTGCTCAGCTGATCTGCTCTTCTCTTT
GTGTCGTAGCACACTGCTCGAGAGTCACGTGCGAGANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGGATGGACGATATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTCTCCC
GGGGAATTGAGATGTCTCGGTCACGAAGACACTCACTTGTCTCGAAGAGAGATGATGACA
TAAAAATCATGCTCAATAGGATCCTGCTGAGGCCCAGAGAGAAACTCCTTTTCCCTAACG
TTAATGATCTGCTTTAGAGGAGACCCCCATTTGGATCCCTTTTTCCTCCACCAAGTGATC
AAAAACTCCTCCCTGACCGATTGTGGTCATGCTGATTCCTTGGCTCTTTTCGTCTTTTTC
TGTCATTTCGAAAGACCTGCTTTCAGGAGATTCACCACCGAAAGAACTCAAGGTGAGTGA
ATGACGGCGGTTTTCCCTTGTCTCTGGTGACACTTAGACAAGTGAAAATGGAGCCCAAGA
GGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCG
ATTGACCAAGTGGCGGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTAGAAG
AATTTCCACTTGAGTAATTTTTGCTAGTCCGGTTCCCAGTCGGGTATGCCTACGGAAGTT
TGAGAATATTTTCAACTCTCAACTCTTTACGGGATGGGAGTGTGTAGCAGCTCTACTGGA
GAAACCAGAGAGACTTGCCCTAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGA
TCTCCAGGGCCTCTTTCCCAGACATCTTGGTATTGGATGAAGACTGGAGTAGCCTGACAC
CTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCACTATCTGAGTCAAAAAGCTAATGCC
AGGCTCAATACCAGTTCGGTACGTGGGTCGCGAGCGTCATGACTAGTTTCAGGTTCATAC
CACAGGAGGTCAGGATCTGCTGACAGTCTAATCAGGCAATGCAGGCATAACTGCTGCCTT
CCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGA
ACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATGTACGGGAGGAGATGTGT
TCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCATGGCTCAG
TGGTGAAATGAAAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved