Loxodonta_africana Locus Poly:34:SNORA73
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Poly:34:SNORA73
Loxodonta_africana
Poly:34:SNORA73
GeneScaffold_7384
SNORA73, SNORA73
1001..1206, 2079..2283
3283
ACGTGTGACATGGCAGATTCAATCCCTTTTGAGACCGTTTGCGTTTCTCAAAATGTCTT
GTTCTATTTTGCATACTTACTATCTCAAAGGTTTTTTGGCCAGTTTATCTANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAATGGACGCTCGTTGACTACCGCGCGC
TGGTGATGGTATAAATAAGGGTTTTCTGTCCCCACTCGTTCTCTTGCGTGAAGGCGAGCT
CTGGGTCGCTTCGGTCTTGGTGAGTGTTTTTGCTTCGTGGCCTCTCATCTCTACCTCTAG
CATTCTGCTCGGCTACCAGCCTTTCCTGTGAGCACAGCCTTCAGCGGCGACTGTGCTGAC
TGCGCTCCTAAGTGCGACCGGACTGAGAGTAACTTCGGCCGCGTGCGGCCGCCGAAGGCC
CGCGGAGCCCCAGGGCCTGGGCTTTCAGCAGGGGCTGCGGGCAGCGCCACCCCGAGGCTT
GTGAGGCTGCCGCACCGCTCGTCAGAACGCTGAGTGGCGCAGCTCCCCTATTCATTGCCT
ATTTGCGCCTTTAATTTTTCGGCTTCCTCAGAGGCACTTTGTGCGCGATGAAGTTGCGTG
TAAGACGCCTTGTTCCTGATCTTCTCAGTTGAAGAGTTACTGAGCTTTTGAGACACTCCT
AGGTGCTGTTACTAAATTTACCACGTGATTTGTTGTGATTTGGGACAACTAACGACTGTA
GGTCTTCCACTGAGATGTAGCATTTACGAGACGTCTTGCTGCTCACGAGCTGTTAGCATA
CCGTTCCGTCGTTTGCCGATGGGCTGTTGAGGTTTCTCAATGTGCTTGCTGGGGTTGCAA
GTTAAGAGGTTCGGGCCTACGCTGGGGAAATCGGTATCAACTAGGTAAGATGGTTGTTTA
ATACAGTCGTCTGTAAATTGAACCAGTGATTAGTGACCATTCCAACGTGGATATTCCCGG
GAGGTCACTCTCCCCGGGCTCTGTCCTGGTGGCGCAGAGGGAGCATAGGGCTTTGCCCCG
TGATGTACAATCCCTTTCCACGACGTTGGAGATAAAGCCGGGCGTTGAGTCTGCGCCTGC
ATATTCCTACAGCTTCTCAGAGTCCTGCGGACAATGACTGAGGAGACAAACCATGCAGGA
AACAGCCCCTAATCTTGTAAGAGGTCTCTGGATTCTTTAGTAATTTCTAACCAGGAAGCA
GAAATTTGTACTCAATAGAGAGGAATGATACGGTTGCTAGACTACATTGCTGCCCTCACG
ATAGGGGTAGGCTGTATTTGGGCTTCAGATCAGAACTGTTGGAGGACGACTAACCACTTT
ACTCTTTACATTGTTTTAACTTCAGGGAAATCTCTGCAGGGCTGTTAACATGAGCCCTAA
AACGCTTTGCACTAGTTCATTGGTACATGTGGATTATAAAATAATTTTAATAATTCCAAA
GCCAGTTCTCTGTCGCATACCAGTAACTGTTTCTCAGTTTGTTACGTCCAAATATCGACT
AGGTCTTGTATTTTATGACATTTCTTTAAGCATGTTGACAGTTTCTTCCATGTGCCCTCA
CGTTCTGTGGAGAGTGCTTTTATCATTCTGCTCCGTGAAACGGTGCTAAGTTTTTCCCAT
CTTCATTTCTTCGCCTGACAGGGGTATTGATACTTTATAGATGAAGAAATTTGAGACTGA
GATGGGATGATTTTGCCAAATTCTTAGTGGCAAACCTTGCACACATGTGATATACAACAT
GCATGTGTGCTTTTGTGTATCCATAGCTTTTCAGTTCTGTGAACAGTGATTAAGTAGGAA
AGCCACATTAGAAACAGTGGCAGTGATTGGATGTGGTTTTGAACCCTTAAAACCATTACT
AACCCTAATGGTCTTATTTTTGCAGGGTTTTCTCAAATCTACTTCCATACTCTGAGGTGA
GTAAATTATGGGAGTCAGTGGAAATGTTTTGAGGAATGCTGTTTTCTAGCAATATTGCCT
TTGTAAATGACTAATTACAATGACTAGTCAAGAGGCATTCCAACGTGGATATTCCCGGGA
GGTCACTCTCCCCGGGCTCTGTCCTGGTGGCGCAGGGGAGCATAGGGCTCTGCCCCTTGA
TGTACAATCCCTTTCCACGACGTTGGAGATAAAGCCGGGCCTTGAGTCTGCGCCTGCATA
TTCCTACAGCTTCTCAGAGTCGTGCAGACAATGACTGAGGAGACAAACCATGCAGGAAAC
ATGTCTAATATACTAAAATTAAAAACTGAAGACCTAATGAGAGTCTAAACCAGTTTTTTT
GTTTTTCCTTTCATTTAGGAGAGAAGAGGAGGAGCCTCACTTTTGGGCAGAAGTTGAAAG
TTAATGTTTTTCTAAGAGTCTGAAAGACATGAAGTTTTTCATTGGCTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved