Loxodonta_africana Locus Mono:38:SNORA70
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:38:SNORA70
Loxodonta_africana
Mono:38:SNORA70
scaffold_75091
SNORA70
1001..1125
2125
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCATAGCTCTGAAGTGCTCCAGGCCTCGCTTTGTTCAGGTGGTACATGCAGA
TGGTAACACCAATCTCACAGGTTCTTAAATGGATTAAAGATGATAATTCATGAGAAAAGG
GCCTGAAACACAGTGTTGTTGTTGTTAACTGCCGTCAAGTCGGTTCTGACTCATAGTGAC
CCTATGTACCACAGAACGAAACACTGCCCGGTCCTGCGCCATCTTTACAATCGTTGTTAT
GCTTGAGCCCATTGTTGCAACCACTGTGTCAATCCATCTGGTTGAGGGTCTTCCTCTTTC
CCGCTGACCCTGTATACCCACGGTGGAGGCCTAAAAACTGCTGGCTGGTATGATCGGTAA
GCTTTGCTCCAGCACTTTCCCTCCAGCAGGGCAGGCAGGATCCCCGGGGAAATCTTCTCC
ATCAGCCTTGCTCTGGGAAAGAGAAACAGAAAATATTCTCATTCTAAATAGTAAATGTCA
GAGGCTTGGGAAGGATTCTGAGGTTCTGAAAATAAACCCCCAACACAGAAAGGGAGGAGG
GAAGGTGGGAGAGAGAGGAGGGGGTGAAGGGAGAGGGCCAGGGAGAGGGGCAGGGATGAG
GTATCAAGACTTAGGCAGGGAGAGTGAGAGCGAGAGCTAGAGCGACTTTCATCCTGGACT
AGACTCCACTGAAGCCCCTCCCAGAAAGATGAGGCCTCGGTTTCCTTATCTGTAAAATGC
AGGTGTTAGACTAGGTCACAGGTTGTAAATTGGCACCTGTGGGATGTATCCAGTCTACAA
ACATGCCTTTTCTTTTTCTGCATAATGTGTTTTTTAAATATTGAATGAATTTTTCCAGTG
CTTAAAAATTGAGATATTTTGCATAAAAATCTGTATTCCTTCTACAGTCAGCTAAATTGA
CTGTCCTCTTGCCTTGTGGGGGCCAGTGAGCAATGGCTGCAAACAGCAGCCTCGTCAGTA
GGGTACCCAACCTGTTGCACATATAGGTTGCCTAAAGGAGACAGCCCTTTCCTGCTCTTT
AATGCCTCCGACCTCGTTAATTTCTGCTGTCCCTAATCTAAGCTCCAGACAGGTATGTGG
GGTGCCTTTGGAAAACCCCGGGGTGGAGTAGCCAGGGCTCACGTTGGCCAAATCATCAAG
TCCATCTGCGCCAAGCTTCAAAACAAGGAGCATGTGATTGAGGCCCTACGCAGGGCCAAG
TTCAAGTTCCCTGGGTGGCAGAAGATCCACATCTCCTTGAGGTGGGGCTTTACCAAGTTT
AATGCTGATGAGTTTGAAGATGTGGTGGCTGAAAATGGCCTCATCCCAGATGGTTGTGGA
GTTAAATACATCCCCAATCATGGCCCCTAGGACAGGTGGTGGCCCTGCATTCATGAGGGC
CTTAGTAGCACTGCCTCTTTTGACCTGTGCCCACCAATGTATTGACCTTCCTATCTCTGT
GTTGCACACCAATAAATTGAACTTCCTGTCCCCCCCCCCCAAAAAAAAATCTGTATTCCT
GTTTGTCTTGACACTTTGGGAGGTCTGGCTACACTGGGCTGGCCTTCTGGCCTGGAAGGT
TTGTGTAGCTGGGTAGCTTTTGCTGCTGTAGACAGGCACAGGTGCTTCAGTTTGCCATAG
TCCCCACCATGCCTGTCTGTCCTTTAGCTTGAGGCTGAGCACTAGTTGTTTTTGGCATTA
TGTTTGCCCTATTTTGTCCCTTATGCCAGAACATGTCAACCTCTGGCATGTGGAAGATTC
CAGATGGTGACTCCTGGACTGAGATCTGTTCTGCTCGGATATTCTATGACTCTCACAGCT
CTAATGTCACCCCCTCAGAGAGACCTTCCTTGACCACACGCCTGCCTCCTTCATTCTTCA
TCCCACTGTCAGGAGTCAGTGACCAAACAAACCAGGAAACAGTACAAGTGGATGGGCTGG
CTGTCCTGGGGTCAGGCTTCACAGGAGCAGAGTGGCTGGTGAAGGATCCGTTTCTGCCCT
CACATTGGGCAGTGAGGGCCTTGCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved