Loxodonta_africana Locus Mono:65:SNORD115
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:65:SNORD115
Loxodonta_africana
Mono:65:SNORD115
scaffold_196313
SNORD115
1001..1078
1126
AATCCTGGCATTGAATGAACAGTCGAGTAGTCTGATACCTCACTGTCGCTATCAAGAAA
AGGTAACAGCACAAATATCTGAGTCAAAAAACTAATGTCAGGTTCGATGGCACTTGGTAA
ACGCGATGCGCGCGTCATGACTAGTTTCAGGTACGTGCCACAGGAAGTCACGATCGGCTA
ACACTCTAGTCAGGAAATGCAGGCATAACTGCTGCCTTCCACATGCAGAAAGAGCACTTT
CTGCACAGTTCTTTGGAATCTCATATTCTATAGAACTGCTTTTCTGTATGCCCCACAGGA
TCCTGTGGTGGTTGATATACAGGGGGAGATGTTCTCCCTCTATAGGGATTATTCGGGCCT
GAGGTAGATTGGATTGTGTCTCTACATGGCTCAGTGGTGAAATCAAAGTGTTGGAGGACT
GTGGAAATTTCTAGAAGTGTTGGCCCAATTCTTGGAAAGTAATTCATTTCCAAATGTCCT
TCCAGCTGATTTGAAGATTCCCAGTTACTTGGGACTCTTGGGTGCCATTTCCCGGGAGTC
CAATACGTTGGACAGTGCCCCTGGACGCATATTTTGCTGCCTTCAAGACACCAGTCAGGG
TTAATCGATTGCAAAGGCTCCTTTTGCCTGTTTCCTCCTAAGAATTTGTACTACATCCAG
GCACGATTCTCACCTTGTGTCAAGGGTCAACAGTCTCCCCAGTGGGCTGTAAATGAGTGT
CTTGATTTTGTGCATATGTTTGCGAATATCTGGGAGAAAGCATAGCCATAGGGAAATGAG
CTTCTTTCCTGTGATCTTTGTCTTACTGATTTGCCCTTTTCCAAGGGATAGTGAGGTCGA
TGTCTGTTGTCCTGCTTTCATGGGGGTCAAGCCAACTCCCCTGGAAACTGGAAGACGATG
TGTGAATTCTCTCACCCAGTGTCATTCCTCAGTGGAAGAAAGACATTTGTGGTAAGCATC
TTCAGGTCTCAGGGGATTTTTCCTGGGGAGAGATATGGCTCGGGTCACTGATGACATAAC
CTGTCTCGAAGAGAGATGATGACCTAAAAATCATGCTCAGTGGGTTTATGCTGAGGCCCT
GGGAGACACTCCTTTGCCCCTGCCTTATAGATCTTCTTTAGAGCAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved