Hordeum_vulgare Locus poly:snoZ188
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:snoZ188
Hordeum_vulgare
poly:snoZ188
chr5H
snoZ188, snoZ188
1001..1111, 1275..1385
2110
TTCAAAAAAAAGTTATTTAACCTTCTAGTCATGATAGATAATTTTGAAAGAATTTTCGT
TGATAGGCGATCATACTACTCACACTAATAAGAAGTTGTTTTTCTTAGCACTAAAGTTGC
CTAAATATCATCCCAAAGTTGCTCAAAAAAAGTTTATCGAAACCTGTTCATATGGAATCT
AGTTTGAAGAGCTAGTCGTAAGAAACACAACCGTGAAAACGGATCGTCGTTCTGACGATC
GGTTCGAAGTTATAGTATTTGAAAAAAGTACGAAATAAAGTGGAATGACTTGCTGCACAA
TTACCCGTGAGGAGCCAGGTAGCAAGCCTGTTAAGCTATCTTAAAAAACAACAATTACGT
GTGAGGGATGTGTTCGTTCCAGTCAAATAGCACAGCTGTATTTTTGGTATTTGGGAAATA
AAATAGAGATGCTCGTGGACTTATGATGCTTTACTTTGCCTAAAGAAAATGATGATTTCC
TGCTTTCGAAGGCAACATCAAAGTTATACCCCCTAAAAAAGGCAACATCAAAGCTCTTTT
TTTTACGGCACCACCTGCATGAGCTCGGCGGAAAAAAAAAATCCTGCATGAGCTCTGCCA
CCGGGGCCGGGCACCGAGACGGGATAAGCCAGAGAGACCCAATCATCCGACCACAGCGAG
ATCGCCAAATCCTAGCCATCCGTCGCTTCCGTGGCCGCTGCGCAAAGACAGCTGTAGTAT
TTAGGACCACCCACATCCATCTGCTTCATTCTCCTCGCCTCGCCTCGCCTCGCCGCTCTT
CTCCTCATCTCCAGCTCCAACCAACCTTTGTTGTCTTGTCCCGTCTGCCAGCCTGCCTGC
TTCCCAGAGTTCTTATTCTCATCTGAATTCGTGATTTCACTTTATTTGGCTGGCCCCGTC
AGTTTCGGCTGCTGTGTTCGTTCTTGATTTGCCGGCGAGGTCTCCGATTCGAGGCTTGCT
CCTTTTCTTTCTGGCCCAGTTCATGTGTTTGTTTTATTTCGGCGTGCCGGTGATGATGCA
AAAGCATCGGTGAATTCTGGATGAACGCGCTTGCGCACCACCGGTGCGCACAGCTCTGGT
GATATCCACTGCGTGATACTCTGAGGCACACATCCTTTGAATTCGTGGTTTCATTTTATT
TGGCTGCAGGTTGAGTTCCGGTTTCGTCTTTCAGTTTCACCATCCGCGCTGCGTGAGCTT
CGGCTGCTGTGTTCGTTCTTGGTCATGCCGGTGAGATCTCCCGCTTCGAGGCTTCTTTTT
TCGTGGTTTGTTTCCGCGTGCCGATGATGATGCACAAGCACCGGTGAATTCTGGATGATT
GCGCTTGCGCACCATCGCTGCGCACAGCTCTCGTGATATCCACTGCGTAATACTCTGAGG
CACACATGACACATCCATCCATGTTCTGAACCTTCGGTTTCTTTTGCTCCATTACAAGGC
TGATTCGAGGGAATAGATTAGCTTCTTTGGAGCTCAATTGGTCTCCGACAGACTTGCATC
ATGCTAGTAGTATTTTTTTTCCTGATCTTTTTGCGTTGCATACCTGCTGAATTCTTGCAC
ACAGATTTCACCGACTGAGATTTTTCGCAGCACGGGAAAAAAATCGGCACCGAGCTGGTT
ACGGCCGTAAATGTTACATTCAGGTTTCAAGAATGGGCTAGAAGAACCTTCAAAGTTTTC
TACCTTCCCGAGAAAAGGCACTCAAACGATTAGATTTCCTCCTCCTCCGGTTGGCGCTGC
CGCCGGTCCGCCCCGCCTCCAGTCACCTTTCGGCTATGGAGGTGCGCACGACCTCGCCCC
GGCCGGCGGGAGGGACCCGCTCTTTGTTCTTGATAGAATGATAGGTTCAACGTGTTGGTT
GGAGCTGATTCTAAATATAATTTTTTTAGAAGATTAAATAAGATCTTTAAGATATCTTAG
TATTTGGATCATATTAGAAATTGTCAAGCGGCATTATGGAGGGACTACAGTTTTGCTCTC
CAGTTTTCTCGCGTGAAACAATTATATAAGTTATATTTGCATATTATATTTTCATACTGT
GTTGTTCACAGGTTTGTACGTGCTTTGTTTCTTGTCTAACAGCAGGTGATCAAGTTTGCT
CTGTTTTGAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved