Hordeum_vulgare Locus poly:snoZ159
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:snoZ159
Hordeum_vulgare
poly:snoZ159
chr6H
snoR1, snoR1, snoR1, snoZ278, snoZ278, snoR64, snoZ103, snoZ223, snoZ159, snoZ159
1001..1093, 1164..1252, 1341..1442, 2807..2921, 3144..3259, 4000..4093, 4275..4374, 5583..5678, 5836..5927, 6009..6100
7099
TGAAAAATGTGTTGCTTCAAATTCGAAAAGAAAAGGATAAAGGAAAGAGAAAAACGAAC
CAAAACAAAAAGAAAGGAAATAAGCAGAAAAAAAAGGAACAGAAAAAAATAAAAAAGGAA
AACTTCAAATTTTCGTAAGACAAAAAAACAACCGGACTTGTCCACTCGGGCGACCCCTGT
GCATCCGCTTGGCAGTTCGCGGCAACGAGCGATGCATAGGAGGGGCAAACCCTCTTTAGC
GCCACAGACGTCTGTTACATGCAAATTTTGCTAAGGGGCACTTGCAACGCTCTACAATGG
ACCGGTCCATCTAGAGATATTGTGTGCGTTTTAGTGTGTGAACTTTTTTCAAAATCGATG
AAGCTTTTTAAATAGCATTGAACTTTTTTTATTGAAATTGGTGAACTTTTTTGAAAATCA
GTGAACATAATTTAAATTTCGTAAGCTTTTTTGAAAATCAATGTACTGTTTTTAAAAGTC
GATGATTCTTTTTCGAATTCTATGAATTTTATGAAAATTCATGAAGATATTTCAAAAATC
GGTGAACCTTTTTTCATAATCATTGATTTTTTTTTTTGTAAATCTGAACTTTTAAAAATT
CTATGATATTTTTTTCAATATTTTAGTAATCAACGGATTCTATATGAACCGGCCCACGAG
AAGGAGCGATGGAGGCGCCGGTTCCGGTAGGTCCCGAAACAACGTGCTAAAACAAAGAAA
CTTCAGTGCTTTCTTTTTAGCAACCCATTACAATTCCATAGGACGAAAGGCCCACCCGAA
ATCTTGGCCCACTCCCACGCACTCTCTATATAACTCAACCGTGGGCATAGGTTCCTACAC
AGCACCTCTCTAGGGTTTGAACTGCCGCCGCCGCCGCCGCCGCCGACGCACCCCACGGCC
TCTATTTCTCTCGCCGTCTCTTTGTCCTCTCCTCTTTGGCTTCATCTCTACTTCTCTCGC
CGTCTCATCTGCCATTAGATGTCGATCTTCCGTTGTTTTTGTGCCGTGATGATTGCTTTA
TTTCTGACACCTCTTGTACGAGAAGCGCCTTGATGCGCTTCGCTGAGCAGATCACAGCAA
ACATATCTGAGCACAGCCACACAACGATTTGTTTGCTTATTTTGTATGGATTTGCAACAG
CACAGTATATTGGTCATATTCGTTGGCCATGATGAGCACTGCTTATTTCTGACACCTCTT
GTATGAGAAGGGACTCGTCCCTTCCATGAGCAGATTAGCAACCCTCTGAGCTCATCTTAT
GACCGTTGGCTCTTACCGCTGATGTTTATTTTCTTCTTGGTTGTTTGCCTTGGCATTCGG
TAGTTCCGTAGTAGTATGAACAGCTGTGATGAGCATCGCTTTCTTCTGACACCTCTTGTA
TGAGAAGTGCGCCTCTCTAGGGGCTGCACTTCGTTGAGCAGAGTATAGCAAATGTCTGAG
CTTTTCTTTATGTTCCGTTGCCATCATCTTTAAGGTAGCCTGTTGCAGTTGTTCTCCTTG
TTGAATCTGAGATCAGTCGTGTGTTCTCGTCTTTTAAATCCTTTTTTTTAACGTTGCATT
GCTTGCTCTATGGTCAAATACCCTTCCCGCTGGATCATAAAAAAACGAGGTTGAGGCAGA
TTGTATTACTAAGGATAAAGTAGAGCAAGAAGTCTTTCAGTTGTTGATGATCATTAGTGA
AAATGTTGTACATTCGAATGAGAAAGGAGGCCTATCCGAGAGGAAATAATCGTTTGTTTT
CTTGGTGAATGTAAAAGCTGACAAGGATCTGTGAGCATATTGATCTAAATTTATCTTCCT
TGTGTACATGCAGTGCTCTGCAGCTATCTTGTTGGAAGGTAAAGGTCAGCTATCTTTTTG
GAAGGTAAAGGTTGTACACAATTTGGAGGCAGTACTCAATTTGCGACGCAATATTTTGCC
ATGTGAACTTGACAGATTGCCATTTTTACAAAGGCCAAACCAATTTTTAGTTTTCCTCTT
CATGGAAAAAAGGATTAGCTTACCTGGAGGTGCTATATTAGTCACTTCACCAACGCTCTC
ACAAGTATTACCTCTTAGGCTGAAAAACTTGCAGATTATGTATGTTTCTACAAGGTGGGA
GTTAAACACTCATGCATTCTGTCTGAATCATCTGTGCAGCAGAACCTGCTACAAGATATT
TGAAGAAATAAACTCATGTTCAGTTCAGAATTGCAATATGTTTGCTTTAAAACGTAAAAC
AATGCAGGCAGTGATGACCCAGGAAATCAACAGTACATAATGAACAACACATATTTTGTG
TGCTTTGTTATCCGGTCTTGACTTTTGATATGTTTGTGCTTCATCATCTGGTCATTGGAA
TGTTCAGTCTCTTGAGTCTGATCTGTTTCCACTCGACTCGTTCCCTTGAAGCTACAGTTT
TCTGTTGTATCTGAGTTCGCCCCTCTTTTATGCCCTCTGAGTTCTCTCGAAGGCACTGGC
AGCTCTTACATACATGCACATGTCATACAAAAATGCCCGTCCACACTTTTGGTATTTTGA
TTTTGACAGCTGTGACGCTAATTTTGTAGTTACAGACCTGTAATGACTCCTGTGGAAGTG
ATCGCACGGTTGCTTCTCTTAACAGTATTTTCTTAACAGTATTTTCTTAACAGTATTTGT
GTCTAAATAGTATTCTTCTTGCTATCCAGCGTGGAATTTCTTTTAATCAGTTACCCTACA
CTCTCAATGGAAAATTCTATGTGTGTAGTTGTTAAACCTTTGTATTTGCCATGTGTACTT
GATCTGAATTGCGAGCTTGTAATTTGTTATGAAACATTGTCTGAAATGCCAATGATGACA
TGCCCAACAGTTGGAGGTGCAGATGTCTCCAGGATCCTGTTTACAGGATGAACCTACCTG
GAGGCGCTGTATCCACATGACATCCATGGGCAATCTGAGGTTCTGATCACCGGTTTTCAA
CTTTGTTTTCAACAAAGTGCCACATGCATCGTTGTGAAAACTTTCTGTTTGGATGCCTAA
GTTTCATTTGTTTTTATTTTTTGATGGCAACTATACTTGTAATAAAAATTTTAGGTCTGT
GTTACGTTGTGCAACACGTGGCACTTACCATTTGGGTAAAATTATGCGTTTGTGTATGAT
CTTAGCTGAAGCATCATCTGAAATGCCAATGATGTCATGCCCAATATTTGGAGGTGCAGA
TGGCTCCAGGATCCTGTTTACAGGATGAACCTACCTGGAGGCGCTGTAACCACATGACAT
CAATGGGCAAGTCTGAGGTTCTGATCACATTAAACTTTTCTTCCAGTTTTCAACTTTTTT
TTTCAACAGATAAGTGCAACATGCGTGGTTGTGAAGCGTAACTTTCTGATTGGATGCCAA
GTTTCAGTTTTTTTTTTCTGATGGCAACTTTAGTTGTAATAAAAATGGTAAGCCTGTGTT
ACTTTGCTACAAGTGGCACTTACCATTTGGGTAAAACTAAGTGTTTGTATCATCTTAGCT
TAGTTTAACTATCCTCTCACAAGTATTACATCTATCTCAAAGTATAAGATGTTTTTAGCA
GAAGAGGCTGAAAATCTCACGTTCAATCTAGTTCCAGTTCAGAAATCCAATCTTATTTGC
CTTAAACCATAGATAACCGATGCACAAGGACTTAAAAATGTTAACTATTCATTTTATTTT
CACTTTATATTATTTTCTGGAGACAATGTTAAATGATTTACCTGTGGTTAGGATGTAGCT
CCAGGATGAGAACAATGCAACAATATGATCTATGATCTGATTGTTAGTATTCAAGTCTTT
GATCATCACTTCGCCAAGAAAAACATTTATCTTGTTTTTCGTTTCCAAAAGTTGATCTTT
GTGGGATGTGATGAAGCAAAGTTGGTCCGTGTTTCTGATGTACAGTGACTGATAACCATC
TTTAATTTCCTTCTGATCCTGCATGAAGCCCCATTTTTGTTCATCCATTTTCCTTGTAAT
TGTCTTATCTAGATATTTTCTTAATTTGTGTAGTTTTATGTCGTTGTGGTGATGAATTAT
GAGTTTTTGCATGTTAGACTTCAGAGATGCATCTGGTGTCAATGAGAAGTCATATCATAT
GCCTGAGCAATGAAATACCATCTGTAATGTTTCAGGACTTCCTCACCCTTGACTTGCAAC
TGTGGATGCTTTTGCCATTTATATTGGTGGAAGATTTTTTGTATGTGTTGCAACAAAACA
TGGTTGCCACGATGCAGGAAAATAACACAGAATATTATTGCATATTAAACATTGAATGCA
CTGCACAGAAAATTAATGGATGTGAGGACTCTTTCCCCAAATTATTGACTGTGATTATAC
TGTGCGCAACTGTAATCCTTCATTGGAGGATTCCAAGCCAGAAGTCTGATCCGTCTTGGT
TTGTTCTTTTCTATCATTCCTATTTGGATTTGTTTCATTTTTTAGAAGTTTAGAATGGGA
TACGAGGATCCTTTCCCGAAATGATCGACTATAATCATACAGTTATACTGTGTGCTGTTG
CAATCCTTATCAGAGGATATACAGTTATACAGATATTTCTTCCTTGATTTTTTCGTCTAT
TGTTTGTTGATTCTCTTCCTTCACTTTTGGTCGGTTACTGTTTGGTTGTATGTGTCTTCT
GATGTCATGGATGAAGATATGCACTGGGCTCTGAGCAGCGGACATTGCTGCAGTCTGATG
GAGATGCACTTGCCTAGAAAGCATTGTCTGACCGCTCAACCATTTGTTATGATTCTGTGT
AATGTTTCTGTTTGATTTTTCTTTTCTTGTTGGAGATTATTGTTTATGGATCCTGGTGAT
GACTTGTTATGTTAAAAAGTAGTGGCCTGATTAATACATTGATGAGATCTATATTATCAC
TCTGAGGGATCTATATTAATACTTGTTTTTTATCTGTCTGTTTTTTGACTAATTTTCTGC
TGGAGAAATATGTTCATATTTTTTTTATTTTCTTTGATCTTTGTTGATGATTTTTAGTCT
AAAATCTTCTCTATGAAGATCTTAGTGGGACGTAGCGGACGCGGATAGAGAAATGGTTTA
CTTACCAACCCTTTGCAGCGTTTGCTATTGCTCTTGGGTTAAATGGTCTAACCAAGATTC
TCTTCTCAGATATTATTCTTAAAATTTTAGATTTATGTAAGTTTCTGAGCTGGCAAATGA
TGATCCGATATCCTACACACTCAATGGAAAATTCCATGTGTGGACTAATAATCTCATCTC
ATTATCTGATGCCTTGCACAAAGTGCTCTATTTGTCTTCCTTGTTTTGCCATACAAGATT
ATCAAACCCAGGGTTGCAAATGATGTCAAATATTATGTGCTAAACACTGAATCTTTTATA
TGTTTACAAAACTCCGCTTATTATCTGATGCAACCCATCAACTTCAAAAGACTTTTATCA
AGTTATCTTATCTGCACATATGCCCATCTCTTATGTGGATTTCTTTGGATTAGTGGGAAT
CTTACCCGTGCTTCTGATTAATTTATGAAGCACAAGGGAAAACATGATTGAATTTCTTAT
TATGTGCTGAAAAGATCAATTCTCTTTATTGTCATTCTTTTAGATTTATGTGTTTTGGTT
TACCATTGATGTGATGATAAAACAATTTCAGCAAACATGCCAGTTCTGCTTCTGAAAATT
CATGACTGAAAATATGTTATACAATATCTGAGCCATTGCACCTTCTTTTAGATTTATATG
TGTGCTGATTTGACCATGGTTGTGGTGAAAAACACTTTCATCAAAGCAAGTTCTGTATCT
TATGTTGTTTATGTGCTGTTTTCTGCTTATAGTTTGCAATAAGAATGTGTTGTGCTTTTT
TATCTAATGTTGGAAGCTGTCTGATGATGATCAAACTAAATACTTTCGTTCTTCTGATGC
GCTAAGGTGCGATGCGGAAGCAATTTGGAGACCTGAACTGAGGATATTGTTGATCTTATT
TTTATGTGCTATTTTCTGTTTGTAGTTTGCAATAAGAGTGTTTTGTGCTTTTTTATCTGA
TGTTGGAAGCTGTCCGATGATGATCAAACTAAATACTTTCGTTCTTCTGATGTGCTAAGG
TGCGATGCAGAAGCAATTTGGAGACCTGAACTGAGGATATTGTAGATCTTATTGTTTGGT
TTGATCTGCTGCTCTTTGTTAGGAAAGCAACTTGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved