Hordeum_vulgare Locus poly:snoZ152
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:snoZ152
Hordeum_vulgare
poly:snoZ152
chr1H
snoZ152, SNORD14, snoZ155, SNOR75, SNOR75, snoZ103, SNORD14
1001..1095, 1481..1604, 1853..1933, 2755..2842, 2946..3033, 3518..3613, 4037..4158
5157
GGAGTATTTTTTCATCTAGATTTTATCTCTCCAACGTTTTTCTTTCTCGTTCTTTGTTG
TTCCTCAAGTTTGAGAGCTCCGAATTCCAAAGCTCCAAGGGCAAGCGAATCGACCTACGG
CAGCCCATAGCCGCCGCACTCCTTGACATGATCCTTTTCCGGACATGCGGGGTTTCGAGT
CTACAAAAGTGTCCGTCGGCTGTCTTGCATATCGCGTTGCCGGTCGTACCTTCTTCGATG
TGAGCTGTGGTGTATCATCCCTAATGTCGAGGATACACGATGACGTGTTCGTGTGTCAAT
AATGAGTTCACTATTTTTTTCAGGAAAGCCCGCGATCCAGTCAGATTCCGCATCTGGGCC
GAACCGGGTCCGCTAACGTCCAAGCATATTGTGGCCCATATTCGGTGCCCAAGGGAAGCT
GAAACCCTGACAAAGAACCCCTGCGGCGGCGGCGGCGGCGGCTGCGGTGGCTATATATTA
TGAGCAGACCCGCGCACAATCCCATCGTCGGCGCCGCCGCACCTCCCTCCATCTTCACCC
TTCGTCGGTCTTGTTTTTCAACTGCTCTTCTCTGCGTGTTGTTCTCGATTTTAATGTTTT
TCGTTCTACATTTTTTGCAAGATCAGCTTCTTGTCTGGATCTCGTTACCCACAACCCCAG
CCAATCGGCAAATCGTCCTGCCATCTTGCTAGACTGAAATCCAAGCCGGCTTTCAACTCA
CCTGGATCTGATTCAGTCGATGATTTTTCGGGCCCTTTCCGTCGGCACAGCACGTAATCT
TCTTATCTTGATTCATATGCGTGGAAGAAAAGCAAATCCACGCCGTCCCAGAGCTTGTCC
TTGTAGGATTTGGTTGGCTGGTGACGATTCAGGTCCGAAAGGATCATGGCGGATTTCAGC
GAGGCGGATTCTTCCGCCGTTGATCGATTCATGTTGTTATTCGCTTCTGTCGATTTCAAA
TCATCCTTTTTTTTTTCTATTATCCTCTTCGTTTTCGTGGTGATGCGATGATGATTCATA
TAGGTTTTTGGCAGTGGTGGCGTCGGTCACCGTGAGCCTTCAAACCAAAAACGACTTCTC
TTTCCACTGAGCATTGCTTAATTTTGTCTTCTTCTTTTCTTTTCTTTTTTGAATGCATCA
TCTTGTCTCGGTGAAGAGCTCTGACCAGGAAGTGCCGTATGACACTGTAAACAACAGCTG
CTTCTCTGCCGCCGCTGCAAGTGTCCATCCCTGCATCATAACCTCTGTGGTTTACTCTGG
GATGGAATACCCATTTGCACCGGCGGCTTGATTCAGCTGTGTGCGTGATTTGAAACGGGT
CTCTGAGGGATTTCTGTAATTCTTTCTCTTCTGTTGCAGCAATAATTTTTTCTTGTTTTC
TTGGGCCCGATGCCCACGTCTCAGGTAGCCACAAGCCTTGACCGGAGATGCTACATTGTC
ATAAGTATTTGGTGCTGTCGATTTTAAATCGAGGAAAACAATGGCGATGATGATACGACT
AAGGCTTGTTTCTCAAAACATTCGCAGATGCCGCCTAAGAGCTTTCGCCCTGCCAGGCTT
TTGAGAGCTAATGCTGCTAATTCCTTCCTTGGATGTCTGAGCCATGCTGGTTTCCTCAGT
CCCAGTTTAATCTTGTTTTTTTTATCTTTCTGCTCATTGTAGGACATTTCACCAATTGCT
TCGGAGAAGAAAAATAAATACAATGACCCAGACAATCCTGAAATATTTCATACGTCTGAA
CCTTCCAAGATCAGTCAAACTGCTTCTCTGTTTCAAATTGTATTTTTATCAGAAATTGTT
TTTGTTCTTGATTTACCTTTGTTGTTAGAAGAGTAGAAAAACAAGATTTATTGAGTTGAT
GTGATGATAATCTTCCACAGAACAATCATATTTAGTGTTGACCAAATTACAGACTACAAT
TATCTGATCAGCTCCTGAATCTTGCTCAACCGGTCTTCAACTGATGTCTTTCAGTACAGA
CAGAGTATCAACTTGATTTTTCATTGGCTTCAACTTCTCTGGTTATTTTGTCTTTTCTGT
GCACAACAAGCTGGTGCTTTGGATGAGAAGTAGTCTGTCGGATTTAGTTAATTATCACTT
TAAATCGTATTGTTCACACTTTCCTAACGTAGGTTAGATCAGCCACGGTTTAGATAGTTT
GTGCAGTGACCTGCACATATGTGCTCTGTGGCTAATTACCCAGTTACACACCAGCCACTA
CCGTGGCTGCAATCTCTGCGTGAATGGTCTGTAAGACCACCCACACTGACTTCCTCGTGC
TTCCTTTTTTGAGACATTAACTCACACAATTGCAAAACTGAAGAATTATTTCACCTGACA
CCACAAATTCATTTACATTTCTTCTTCTTTTTTATTTGATTCGATCTAAAACTTTGAAGG
CAATAATTTAGAGTCTCTGATGTGCTTCTTAATAGTGTAATTCAGCGCTGTACGTTGCCG
AGAGGAATCTTTGGGCTAAGATTCTGGCACAAACCATTCTTTGAGATGGCTTGTCCATTC
AACTTGCCCATACATTTATTAGTGTTGCATTTTATTTGGGTATGGCAGAAGGGTGCCATG
AGGTATCTGATTCTTGGGCTTGATTAATGGCCTTGTTTCTCGTTAGATTGGCAGACAGTG
AGAAGGATATGGGTTTTTGCGACACTGACTGCTTTCATACCAGGAGCTTTCTGTTATTAT
AACCCCGTTTACAATTTTTATCAATTGTTTCATTCTTGCTGCCTGATCCGAGGGTTCTTG
TGATGATGAACACTGATTAGATGTCTGATACAATCCATTCTATTAAACCATGGAGACAAA
ATGAGGCATTTGTCCGAGAGAACATCTGTTATCTACTACTTCCACACTATCAATTATCTT
TGCTTATTCTGTGAGATTAACTGAACTTATGTTTGTTTGGCACTTCCTTTTTCCATTGTT
CTTGGTTCTCTGTGATGCTGAAAACAGATGACGAGTCTGATGTAATCCATTCTATTAAAC
CATGTGGACAATCGAGGCATTTGTCTGAGAGAACGTTGGTTAGTTTGTTTAATATTTGTT
CTTTTTTTGCTGGCATTATGAGGAAGACAATTAGCGTCTGATCTATTTGATTATAAATTC
CTCCTACTCATTCTGAATGTCTAATCGGCATCATACATTCTTTCACGTCAATTGATATGC
GAAAGAACTCTTATATGGGATGCACCATTGGTATCTTTTCTTTAAAAAAACTATGACTTG
ATGGGAGAAGTGATGATATCATAACCATACCACATTTCTGCATTCACTGTGATGATCAAT
TTACATCATGCACTACCATCTGATCTTCCAGTCCTATTTTTTCATATGATTAAACTTTTG
AATTCTGATATCCAATGAGATCACAAAATTTGATATCAACTTGAGCATAACTTTGGATTT
TGAAATAAATCAACATAGTTTTGATACAGCCTGAACCTTATTGCTTTATTTTTTTTTCTA
TTTCATCTTTTTGACTTCTATTTTTTTTCACAAGTTGAATGAATGTGAGGATCCTTCCCC
CCAATGATATACTATGATTATACTATGCACAAATGTCATCGCATCGGGATTCCAAGCTAG
AAATCTGATCCATCATGCTAATTTCCTCATTAGTCTCCTTTGTCGTGTTATTTCTTAGTG
AATATTTTGAATGACAGTGAGGATTCCTTTCCACAAATTATCATGCTCTACTGAAGAGTT
ACTCCAATTGTCACCATAAATCCATTTGCAGTTTGATGATATCTTTAACTTGGCATCAAA
TTTCTGTTCAGTTGCAGCAATTTTTATCTTGTTTTCTTGGTTCTGATGCCATGTCTGTGG
TTGCCCTTGACCGGAGATGCTACATTGTGCCGACAGAGATTTTCACATTTGATAGGAACC
TGTTGCTGTGATTCAGTCAGTACACAGAGCTGTTTCCTGTGATTATACTTCTTGTTTTAC
ATTTGTATTTTTTTTCTTCATTTTTCTTTTGCTTCACATAAGTATTAGGTGTTGTTGATT
TTGAATTGAGGACAAAATGGCAATGACGATACAACTAAGGCTTGTTTCTCAAAACATTCG
CAGATGCCGCCCAAGAGCTTTCGCCCTGCCAGGCTTGAGAGCTAATGCTGCTAATTCCTT
CCTTGGATGTCTGAGCCATGCTCGTTTCCCCAGTTTAATCTTGTTTTTGTTTTCTTTTTT
ATCTTTATGCTGATTGTATTGCGTTTCACCAATTGCTTCAGAGAAGAAAATAAAATATGT
CTCCTAGGCCATGTTTATCAATGAGGGGTGTGCACAATGCACTGTGAGAGTATGGTCGTA
GAACCATGGTCTGCCCATCAGCCCATGTGGTAGCTGTGCATCTGTCTTTCTCGTAAACAT
GGCCTTTGTGATATGAACTCTAACAGTACGTAATTTTTATGAAGGGCAAAGATAACTTTT
TTTCTTTTTTTGAGAGTGCACCAAAGGTGGACCATAGTTTTATAGAAGGGGGCAAAAATT
TACAAGAGACCTAGCGGATGATGTAGGTATACCCACACCACTCAGGACTACAAAGACTAC
TCTATCACAACCCTGACATCATTCATTCTTCTAACTGCTTCTCAGTTTCAATTTTTTTTG
TTCTTGGTTTACCTTTTTTTTTTAACAGAGTGGAAAAACAAGATTTACTGAGTTGATGTG
ATGATAATTTTCCACAGAAAATCATATTTAGTGTTGACCAAATTACAGACTATAATTAGC
TGAACAGCTCCTGAATCTTACTGAACCGATCTTTTCTTTCCTTCCTCTGGATCTTCAACT
GATGTCTTTACGCATTGGTGGTGGCGTGATGATGACTGATATGATATGCACCGGTAATTT
GTAGGGTACCTGCGTCCGTAACGAATGTTCCTGGTGAAAAAGAAGAGTAAATTCCCTTTT
GTATCCCCTATTTTCACATTTTTTGACTCTAATTACCCCATTTAGCGAGATTTCAACCGT
TTTACACCATTTAGCAGAAGTGTTGCCACAATTTACTTTGTTTAATATTATTAGCATTCT
GATCGAAAGGTCCAATCGTGTTGTCCCAGTTTACCCTTTTTGATATTTTTGGAGTTGATG
GTATTCTCATATTATTTATAAAACAAATCATTCTCTTATTATTTGCAACAGATCATGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved