Hordeum_vulgare Locus poly:snoZ122
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:snoZ122
Hordeum_vulgare
poly:snoZ122
chr3H
snoZ119, snoZ119, snoZ119, snoZ119, snoZ122, snoZ122
1001..1095, 1135..1229, 1270..1364, 1516..1615, 1673..1761, 1802..1887
2887
CGACGACGACGACGACGACGTCGACGACGATGGGGAAGAGGACGATGATGAGGGGGTTG
AGGGTGAGGAGAAGGGGTCGGCGCCGCAGCAGGTGGTCGACATCTCCGACGAGGACGACG
ACGGCGGCGATGAAGAGGACGGTGGTGACGATGACGATGACGATGACGACGACGACGACG
ATGACGAGGAGGACGACGATGAAGTGGATGAGGAGGAGGACCCCGAGGTATAAATTTCTC
ATCGTCTCGTATTTTTTTAACATCTCAAATTTATCAGTAATTTCGGTTACGTTTAGTCTA
TGAACATATGGTTCCGTTATGTTAGAGAAATTCCAGATCTGTCTTCAGATCTTGTCGATT
TATGCTTTTCTTAAGTTGCCGTATTTCTCGTAGCTGGCGATAAATGTGTTCAGATCTGGA
AAAAAAGCGAGCCAGACGGGTTGCATCTGGTTAGGTAGATAGATTTAGGAACTGTGAATT
TTTTCTTTTGCTCAACCTGCAGCTTTTTCTGTTGTGTTTGTTTAGATCTTGTCAATTGTA
CTCTGCTATACCGTTTATTTTTTATCTGTTCAGCCTGTTGTGGTAATCGATATTCAGTAG
GCATACCGACCTGCCTTCCGTTGTTGTGTGGTGTCTAGTGTAGGCCGTCAGACTGGTAGC
ACGTCCCTTTTCGAGAATAGTTGAGGACAAAGTATATGCTTCCTTTTTTCCTTTAATATA
AAGAAAAAAAACCTTGTGCAACTGATAAAAGAGAAACCGGGCCATGTTATGCTGTCCATG
AATTATTTTACTATACTAAATCTGGCTCGTGGTATTGCTAAGATATCCTGTGGTCTATGA
GTTATCTTGCTATACTAAATTTGCCTTGTGGTGTTCCTAAGATGGTCCTCAGGAAATCTC
GCTATTTCACACTCAGATCCAAAGACACCTAGATATTCAAATTGTCTGGTGTAGATCTGT
CAGATTTGATAGTAGGCTTCTTTCTGGCCCTGTTTATGTGTGCTTGGAGATGATGATCAT
CAGAGGCTGTTTCTGAGGACGAGCCTATAGCTCTCCCTATGTTGCCAAATAACTGATTTG
CCTATCTGATCCAAAGCACTAGTGAAATACTTTCTATTTTCTTCTCATTATTTTCTCATG
GAGATGATGAATATCAGAGGCTGTTTCTGAGGACGAGCCCAGTGCTCTCCCTATGTTGCC
AAATAACTGATTTGCCTATCTGATCCAAAGCACTAGAGAAATATTTTCTATTTTCTTATT
TTTATTTGGCCATGGGAGATGATGAATATCAGAGGCTGTTTCTGAGGATGAGCCTAGAGC
TCTCCGTATGTTGCAAAATTACTGATTTGCCTATCTGATCCAAAGGACTAGTCAAACACT
TTCAATTTTCTCTCTTCATTTATTTTGTGAAATAGATGATGAATATCTGATGCTGCTTCC
GGGTATGAGCCTTGAGCTCTCCCTATGTTGCAAAATTTCTGATCTGGCCCATAATACTTC
TGTTTTCTCTTATTTATTTTGTAAAGGAGATGATGAACATCAGAGGCTGTTTCTGAGGAT
GGGCCTAGAGCTCTCCCTATGTTGCACAATAACTGATTTGCCTATCTGATCCAAAGCACT
AGTGGTAGATTTTTTTTTCTTGGTTTGTAGTCAGATGAGGGTTTTATTTTCGTTTGGGGA
AATGATGATTAATTCATCACAGATGCCCTTAATGGGCTTTCTTAAAGAATGGTGACAAAT
TGCACGTCAGTCTGATCCCCTAATAGTTTTGTAAACTAAATTGTTAGTGGTATCCACTCT
TATTTGGAAAGTGATGATTGTTTCATCTCAGATGTCCTTTATGGATTATTCAGAATGATG
AGAAATTGCACGTCAGTCTGATTCCAAACTGTTGTTAAACTTTGATTTTGTTGAACTTCG
ACTTGAATCCATCTGTCACTAGCTTATTTTATGTTGATAGTTGTCCCCAAATAATTGGTT
TTCGTTTCTCATCTGTTGTGACTTGAATCTATCTGTCACTAACTGTAATATGCAACTAGC
ATAGTTGTGAGTAGTCAGACTAATTGACACTTGTACTATTTGTTGTTTGGCAGGAGGAGT
TAGGAACTAAATATCTCGTGCAGCCACTTGGCCGTGCTGAAGATGAAGAGCATTCCAGTG
ACTTTGAGCCAGAAGAAAATGGTGATGGTGCTGATGATGAGGAGATTGAGGATGATGATG
CTGAAGAAGATGGTGAGGATTCTGTTAAGGCACAATCCTCTTCAAAGAGAAAGAGGTCTG
GCGGGGAGGATGAAGATAATGATGACGACGATGGTGATGATGAGAAGCCTCCCTCAAAGC
GATAGTCAATTTGTTCTGGCTGATCTGAGATCGTTTCTGCTGAGGGCGAAGAAGGAAAAT
AATCCTCTTCAAGAGGATTGTTGGTAAATGCTGTAGTTTTAGGACATCTGTGGTAGGTGT
AGCAGCTCGAACTTGAGTCTACCCATGTTAGTTGTTAGTGCATACTGCTGATGTTGATTA
GCAGCCTCTGGAAACTTCTGTATGAGCATGAGATATGGGGCTTGTTATATGCTTGTGTAG
CTTCTGATTAAAACCTGTGGAATGTGGATGCGCTTTGTTCCGAATCTTGTATTCATGATA
TTTCTCTTCAACTGGTTATTGCCAGCTAGCTGTTATTACTCTACTGTTATGTCTGCTCTG
ACCTACTTTCTCTGTTCGAAAATACTTGTCATGTGTCTAGATGTGCTTTAGTTTTTGGAC
AGAGAATACTTGTCATGTGCCTAGATGTGCTTTAGTTTTTGCTACCTATATGTGTTTTAG
TTTTTGCGACAAACTTATGGTTCTGTCAAGTTTGATCTACTCTGATCTTTCTTCACATTA
TCAACATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved