Hordeum_vulgare Locus poly:snoZ118
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:snoZ118
Hordeum_vulgare
poly:snoZ118
chr6H
snoZ118, snoZ118
1001..1108, 1257..1366
2365
GTGTTCCACCTACCCCTAAGTGGTAGTTTAGTTGTCCATTGCCATTCTTCGATATCTGT
TCTTGTGATTTATATGCTGCTCTGGTGCAGATATGTCGATACTTGTTGCCACTACACTGA
TCCAGGGATTTACCTTTTCACAGAAAAATGCTGATTTGGCTATATAACTAACTACTTTTA
AGCAATAACTAACAGAGGCAGATGTAGAACATGGATGCTACTTCTCTCAGTAACTACCCC
GTTACGGTGACTGATAAAAGAGACAAGTAGAAAACTGTCTCTACTCCCCGCTGACGCTAA
TAGGTGGTTGTCCCTGAGGGTACCAGAGGGTTGCGGCAGGAGAGGGCCTGCACGGGGAAG
GTTAACTTGCCCTTAAGTATCATTACAACATTATTTTATTTTATTTTTGCGGAAGTATCG
GTGCAACATTTATCTACCATGTTCGCACAAATGATTTTAACTCAGATATATTATTGCTGA
TACAGACATTTATATAGTCTGTGTGGTAAGTCAAAGTTATAGCATTGGTGAGCTAATTAA
TATGGCTCATCTTCTGGAAGATATGTGAGAAATATTCCCATCTCAGATTCATTCTACAAT
TTAGTTACTAAGACACTCCATGAGTTCCCCCGGGCTTGCTTGTGTGATATGATAAAGGAA
GATCGATATTCAATGCAGTATACTCCCTCCGTTCCTTAATATAAGTCTTTTTAGAGATTT
CACTAGAGGACTACATACGGAATAAAATGGGTGAATCTACATTCTAAAGTATGTCTATAT
ACATCCGTATTTAGTCTTCTAGTAGAACCTGCAAAAAGACTTATATATAGGAACAGAGGG
AGTAGTATTCTATTGTAGACCAAAATGTTTGGCTATACTTGGAGCATGTTTCGTCAACAT
GCTGATATCGTTTGTACAAGGTCTTTTGATCTTTTGTTGAATTGTAAACCATGTACTTCA
CTGGGTTCATGGGAGTATGAATAGTTTCCATACCTTTTGTATGCTTGCTGTGATGAACCA
CAAGGACGGTATCTGAGTAAGGTTGCTCTTGAAAAGGCCCTCCTTCCTTGATTAACATCC
TAAACTGATCATAAATTCTTTGCAAGCATGCGGAAATCTGAATTGAACATGGATCCACAA
TGGCTAAGGCTAACATCACCGTGCATCCTTTCCTGCTTGAAATGCAAAGCATGCACTTCG
CTGGGTTCATAGGTTGCATAATCTGACTACTTTTTTTTTTACCTTTGTCTGCTTGTGTGT
TTGCTGTGATGAATCACAAAGACGGTATCTGAGTCAGGCTAGCTCTTGAAAAAGGCCTCC
TTCCTTGATTACACATCCCAAACTGATCATATATTCTGAGCGAACACCCTTCCATGGTTC
CCATTGTAGTGTTTTGTTTTTTGATCATACATCCAGAACAGAAGTGCAGCTATTGATCGT
GAACCTGCTACTTGTGTGAACCGGTAGAGGAGCTTTCAGGGATTCATGCTAACCTTGTGT
CTTGTAGTTTCCACAGGCTACCAACGAATTGGAAAGGCCAAGATGAAGGAGCAATCATCA
AGCCACCCGCTCATCAGGTGGTGGAATGCCTGCCTGGTGGCTTCTCATTCGCAGGAGTCG
TCATATGTTCAAGTTGTTAATGAGTTGATCCTGCAAGCCAATGAAGATTCAGACGACGAG
GTTGCTCTGGAGGCTTGTGACTCTGGTTTGCGTTTTGTTAACATGGTAAATTCAACACGT
CAAGCTCTAATACTACATCCGATTGGTGCTCATTTCTAGATATCTTCACATTTTATCCGT
CTGACATCCTTCAAATTCAATATGAACAATGAGTCACCGATGATGTAGCTAATTGATTGT
GTTTATTTATTAGAGGACTAACTGTAAGTAGTATTTTTCAGGTCAGTGTACTGCGATGCC
CCCTGAAGGATTGCATGAGTTCTTGCCATACTTAATACAAGTACGTGATTTGTCTTGCCT
AAGCTAATGCTGCGGAATCTTGGGCCTGGTTACATTTTTAACCTCATCTGTTAAATTTAT
GTCCTAGACTTTAGTGTTGAACGTGGTCTGCACTGCCGATGATGGAAATGGAATCACTTG
CTGATGCTGAGGTGTGGTAAATTTCTTTGTATCCCCCATGTCTCAGTTTCTCATCATAAT
ATGATATTTTTGGTAGTATCAACAAATAGAGTGTTAAGAACACCAGAATGGTTGTTAAGC
ATGCATGTTGTAATCTGTAAATTATGGCCATGCTTGGTTCAATACTATAATTGAATCTAT
TTTCCTGCTGAAGATTCAGGGCAGTGGCCTATGTATACCAGTTATCAATTGGCTTGATTT
AGGCTGTTGATAGTCAGTGTCTCAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved