Hordeum_vulgare Locus poly:snoZ101
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:snoZ101
Hordeum_vulgare
poly:snoZ101
chr2H
snoZ101, snoZ101, snoZ102_R77, snoZ101
1001..1101, 1329..1426, 1468..1554, 1670..1768
2100
CTCCCTCGCGTAGCGAACCCTAGCCCATCCAGATCGAACACCCCTCCTTCCTCGTCCCC
ATCTCCTCGTCGCCGCCACCTCCTCCCCGCCCCTCCCGATCCCCACCTGCTCCCTGTCCC
CACCTACTCTGGCTTCCAGGTCGCCTAGCTCCGCCTCTCGGCCTCCCCCAACGTCGCGCT
CCACATCATCGAGCGCGACCCGACCATTGCCGCGGCCGCCGTCTCCCAGCGGGCTGAGGG
TGTCCAGCTTTCGCAGCTGCCCCGGCGGCACCACCTGGCCTTCTCCGTGTCCGACTTCAA
CGGGTTCCTCACCGGGCTCAGGACCAACGGCACCGAGCTATTCGAGAAGACCCAGCTCGA
CGGCCGCACGTGCGAGGACTTCTTCTTCGACCCCGATGGTCAGTGAGTCAGGGACCCCTT
CCTTCTCGGGTCCTTCACTACCAACTCGGTAACGATCCCCCGTTCCCCGCCTCAGGGACT
TATTAGTTCAGATTGTGTTTCCGGTCCAATTGCCCATCACGCATCGCAAAAACTGATTAC
CGGCGGATCTCATGGCCGCCCCGTATGAGACGATGCCACAGTGAACCGCCCCGCTGTCGC
CGTTGTACATGGCCTCACTCACCTCTGTGGTGGTCCAGTAGGCGACGCCGGTGTAGATTG
CACGACCCCTCTTACGATTATTAACGACGGTTTTGACCTGCGCACTACAGTATTTTCATC
TTAAAGGTGCCCTCTGTTCTCATTACTGGTGATGGTGGCGAACGCTGCCGAGTTGTCTTA
CGATTCTCTAGATTTATTAGTGATTTGATGAAAGAACAAGTACATTGGCGGCATGCTTAG
CATGTTAGCCCTCTGTTCTGATTAGGTGCCGGTGTTTGGTTAGTGCCTGCACAAACACTT
GTGAGATGTGCTACTAACTAGTTGTAGTGCATCGCAACTAAGAGGCCGTACGAACTGGTG
ATAGAATTTCCTTCTTGTCTTTGTTTCTTGGAGGATTATCGTTGATGCAGATGATGAGAC
ACAAGTTTTATGGGTAATTTGCGTCTGAGGCATTTTAGTGATGTCACACCCTTATCACCT
TGGAGATCTGATGAGTATCTGATAATATCATCTCCATTTGGTATTGTTGTTTTTGATTCA
TTTGGGGTGAGATGAGGATATAAATATATAGTTGATGGATGATATGATGTCCAATGAATC
ATGTATTAGCTCTATCTGATCATACCCCACACTGAATTCTCTAAGAAAGAAAATTTGCCA
GCATGTCTAGTTTCTCTTGTTTTATTTGCTGTTCAATTATTTTTTTGTTGTTGGGAAAAA
TGAACGTCGTTGATGCAGATGAGGAGACACAAGTTTATGGGTAATTTGCATCCGAGGCAT
TTCTGTGATGTCACACTCTTTTCACCTTGGAGATCTGATGCATCTGATGTACTCTATTCT
TCTTTTGTTTTGGGCTTTCAATTGAGAGAGATGAGATGATGAATGAGATTAATTTCCCTA
TTGGTTTGATTGGCTGACATGATGGCCTAAATATTGAACCGAATCTGGTCATCCTGCCTC
CTTCGATATGAAGAGAAATAAATATTTCCTAAGCATTTTTAGTTAAAAGATATGTTTGTG
TTTGATGCAGAATGATAAAAACAGTGTTAGATCAATTCAGATAGAATGGGTTGATGCAGA
TGATGAGACATGAGATTATGGGTAATTTGCACCTGAGGCATTTCTGTGATGTCACCCTCC
TTTTCACCTTGGAGATCTGATGCATCTTCCCTCACTATTGTATTTTTCCCTGCTAGTATT
TTTCTGTGTAAAATAATCAATTTTGGGGTAAGTTAGCAAGAGATGATATGATGAATCAGA
ATAATTTCCCTATTGGTTTGATTGGCTGATATGATGGCCTAAAATACTGAACCGAATCTG
ATCATCTTGCTTTCAACTCACAGTAGTAAAGTCAATCTGTTTTTTCTTGCCTCGCTTTAC
CATTGTTTCATCAATTTTTTTAATCATTTTCTTTGTGCAGAATATATGTACAACTATGCA
TTTTATTTCTGCAGAATATATGTACAATTTTTCCTGTAGAATGTGCACCTGCATTTTATT
T
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved