Hordeum_vulgare Locus poly:snoU36a
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:snoU36a
Hordeum_vulgare
poly:snoU36a
chr7H
snoR134, snoU36a, snoZ223, snoR134, snoU36a
1001..1157, 1213..1298, 1363..1458, 4303..4459, 4515..4600
5599
TAAAAATAAAGAAAAAACAAGAACAAATTATTTAACAATATAAAATAGAAAATAAAAGA
AGAAACAACATATAACTAAATAAATAAATGAGGAAACACAAAATACACGAAGAAGAGGGG
AAAAAGGGGGAATCAAACATATGCAAAAGGACTAGATGAAAAATGAAAATTAGACAGAAA
AAATGGCAGACCAACAAACAAATCAAAAACAAACAGACTTACAATGAAACTGGCTCCAAC
CACTGAGCAGCCCACAACGGCAAGCAAGAAAAAAGAAGACAAAAAAAAGCAGCGCAAATA
CGATCTCGTCATACATTGGATGTTCACAAAACACCATCAGGGCATGTCGTAAAGAAGCAA
AATAAAATCTAATAATAGGTCGGTCGACTGAGACTTCACTAAAACTCAGTCGACTGATTT
TTAACGCTTCAGTTTGTTTTTAGCCACAATTGTACCGTACACCAAATACCACAACAGGCC
CACGCTCTCGACCTACACAGGGCCTAATTTTAACACCCCAGCCCACCTCAGCAATCGAAA
GAGGCCCGGAAAGCCTCCTCCTCCTCCTCCTAGGTTTTCTCCTTTCCCACGCCGTCCCAC
GGCCTCTCCTTCCAGTCGCCGACAGGGAGGCTATAAATATACTCCGAAGCGATCCCCCAA
TCCCACCACTCTCCTAGGGTTCCCAGCAGCCGCCGCCCCCTCCCCCCTCCCCCGTTCATC
CCCTACCTCTCGCTCTCGCCCCCTCTCTCGATTTACTTCGTGCTTTTCTCCCCTTGATCT
ATCCTGCTCATTTGCGTTTTCCTCTCTCGATTCTTGATAAGTTGGCGGCTACCATGCCGT
CATCTTCGCGAGGAGGGGATAGATCGACGCGTCAAGAAATCGTTTCAATTGCCATGTCGT
CCAGTAGGCAATATGATTGTTGCTTGCGTACACTCTTTTTCTTCTGCTCCGGCCCTTCTT
TCTGCTTGGTCTTCTGTAGTTGATGAGTAATTTTCTTGTTCTTGCACGATGCTAACCCCG
GGCTTGTCGGACGGATCTCGGTCCGCTGTGATGAAGGGAAGCCCCAATGCTGTGCTAGAT
CCACACCGCCGTTCAGTGTTGCAGGCCGCGACGCTACGCGTGGATGAGCAGCCTGTGTCA
GAGTAACGGATACATTCGCATTGCATCTGTTCTTTTTTGCTCTGTTTTTGTTTCGGATCT
TGGATGGTTTTGGTGGCTGTGATTAGAATCTTACCCGCGCTTCTGATTAACTCGTGAAGT
ACAAGGGAAAACATGGTTGAATTTCTTAATATGAGCCACTGCAAATACCAAATCCCTCTT
ATTTTCTGCTGTTGATTTTTTGTGTGTTAATAGGTTGATGTGTACATGGCGGTGATGATA
AACACTTTTAGCAAACATGCCAGTTCTGCTTCTGAAAATTCATGACTGAAAAGCCTGTTA
TACCGATCTGAGCCATGATCTGTGAACTTTGTAAACATGCCAGTTCTGCTTCTGAAAATT
CACAACTTTATAAAGTATCGTGTTTGCAGGATGAACCTAGACTAGTCTGAGGTTCTTTGA
TAAAAGGACTGTTCTTTCTTTTTGCTGTTGTTGTATGTTTTATTGCTAGCTCTAGTTTTT
CTTGTTGCCGAGTTTAACTATCCTCTCGCAAGTTTTTCTGATTTGTGGAAGAGGCTGAAA
ATCTCGGGAGAATGTGTGTTGTCATCAGCTTCGTCTCTTGTTCCTACGAGATGGGAGTTA
AATAACAGCACGAGATTTCACAAATTTTCGATGCATCCTTGTAAACTTTTACTTAAAAAA
GTTGAAATGATTTATACCAGGGATGTGAGTTAAATAACAGCACGAGACTTCACAAATATT
CGATGCATCCTTGCAAACTTTTACTTAGAAAAGTTGAAAGGTTTTATATCAGGTGCATCC
TGGCAAACAATTTAAAATAATCTGGAGAAACAATTTGGAATATTCTTTGTAGTTGTTACC
TGAACACTATTCCCAACCTTAATGAAAGTCAGTCGCAAACACCACAAATGTTTTGCTGCA
TCCCTTTAATTCAGTAATAAAGTTAAAAATTAAACTGCTGTGAAATGCAGTAACAATGCT
AAAAATTTAACTGCAGGAATTATTATGTAATAACGGTAACAGAAATTTCACGTTAATCCA
AAAACCGCTTATAACATGCTGTATTCCTCGTCAACTAAACCATTTTCGTGTTTGAATGGT
AACGGCAATAACGAAGATATTTGTACTGGGTATCTTTTTTCGCTTGTACGATCAGTTGTG
CGTATTGGAGGTCAGGTGTTTTGCGTGATTTGTTTAATATGACTTGTGTAAGTTTCTGTA
ATATTTGTTTGTTTTATCCCCTTAGCCCTACATGATGAACTAAATATTTTAGCTATGGAT
TTATGTCCAGATGGAGCTATATTTTTTGTCATAGTTACTCTGATAGGGCTATTATTATGT
CACTTCTGATTGAACGTGTTGTCCAATATAATTCTTTTGTTTTTTGGGAGTAACTGATAT
TGGGAAAATAATATGGCAATGTTGATAAACATATTGCTTGTTTCTCAAAACATTGGCAGT
TGCTGCTAATAGCTCTCTCCCTGTTAGGCTGCCAATGCTGCTAATTTCTTCCTTGGATTG
GATGTCTGAGGGTTGGTGATTTTCCCCTTTGATAACTTATTTATCTTGAAAAACGTAATT
GTACAACAACATATTAAAGTTGCATATTCCCTCCTTTCCGGATTATATGACAAATCTCAA
AAAATTTAGATTTCTATTATTGTAGGCTCATTTTTAGTCTAATTAAGTTGAAATGCTTTG
AGTTCCTCGTCATATTTAATTCATAGAGTTTAGAAAATGCAAATGAGTGGCCATGAATGC
ATTGTTTTCTACCTCCTCCATGCAAGACCAATGAGAAGGAGGATGTTACATTTATTGCCT
CGGAAATTGAATATGTGAGAAATATTTCATTTGGTTAATTAAAACTAGGATCTCTTCTTA
CAATTTATCTTGGTTGATGAGATTTGAGATTTAAGGCCTATAAACCGAAAATGAGGGAGT
ATGTTTTATAATGATTCATGTGTTTCTATTGTTCTTTTGAAAAATCTGTAAATTGTTGTA
CTTTCAGTCTTTGAAATCACTGTTACAACTTTATACCGTGAATGTGCAAAAGTTGTAAAA
GTTAATTGTGTGTATATGAAACAAAGCATCGGCCTTAATGAAAACTGTCAATAGCAAGCG
TTACTTACATATGTGTAATTACTGTCTACTTTTGAATTGATGTGCCCGTTTGTGTATGGC
TCATCCTTGTGTGTCATGAGCCCATGATTTCGGTTTAAGCCTACCCGGTTGTGAAGCATG
AGCCCATTACTCTGTCGGAGACTGCCAAACCTGGCTCCTCCATCTTTGATCACAAACATT
GGCATTGATGTGATGATCGGGACGTTGTATATTTGTATTGCCCCCGGCAAGCCCGCCAAC
ACCACCCTTGCCGACCCGTTTGAATCTTCGTCCTTTTGTACAGGTGCCCCGTCCTTCGCT
CTGAATGTTTCAGCGTGCGTGTCTAAGGGCGAAGTCTTCCTCCTGAAGCTCTTTGGGGCT
GGTGACAGTGATGACGGTGGGGTTGTGAAATTCAGGGAAATTGACCGCAAACCTGGACAA
AATGAAGTGGATTCATTGTCAAAATGTGTCTTTGTTGTGTTTGTGCTGATTAATTTTTTT
ATTTAAACCTGGGATTGAAATCTGTTGCTTGGACCATCCACGGTTAACTTAATTTATTAT
GTCCGTCCTTGTTGGTTCGACATTATTTAATCTGCCCTGTGCGAGGATTCCGTCTCATTT
GCTTCTAGAACCAACTTGTCGTCGTCTCACCACTCATCGGGGACCAAACCCTAGCCGCGT
GCCATGGTTGGCACCTTCCAAAACAAATGCAATGCCCCCTCTATCCGCCGTTGTCTTCCT
GCCAGCCTTGCTAGTGTGTGCTGTTCGGTGCATCAAGTGTGCGGTGGCAACGTGGAGCCA
CAAGGCCGTTTGCCGTTGCCGCCATTCCCTTCCCTTTCATCCCCTACAACTCTCCCAATT
TCTTGATTTTCTTCATGCTTTTTTTCGTTGATCTATCCTGCTTATTTGCGTTTTCCTCTC
TTGATTCTTGATAAGTTGGCGGCCACCATGCCGACATCTTCGCGAAGAGGGGATAGATTG
ACGTGTCAAGAAATCGTTTCAATTGCCATGTCGTCTAGTAGGCAATATGATTGTTGCTTG
TGTACACTTTTTTTGTTTCTCTGTCCCTTTCTTTTGCTTGTTCTTGCACGATGCTAACCC
CGGGCTTGTCGGATGGATCTCGGTCCGCTGTGATGAAGGAAAGCCCCAATGCTGTGCTAG
ATCCACACCGCCGTTCAGTGTTGCAGGCCGCGACGCTACGCGTGGATGAGCAGCCTGTGT
CAGAGTAACGGATACATTCGCATTGCATCTGTTCTTTTTTGCTCTGTTTTTGTTTCGGAT
CTTGGATGGTTTTGGTGGCTGTGATTAGAATCTTACCCGCGCTTCTGATTAACTCGTGAA
GTACAAGGGAAAACATGGTTGAATTTCTTAATATGAGCCACTGCAAATACCAAATCCCTC
TTATTTTCTGCTGTTGATTTTTTGTGTGTTAATAAAGCCTGTTATACTGATCTGAGCCAT
CATGTGTCGACTTTGTAAATCGTACGATTTAGCTGAGTTTCCGATTCTGCAATATTGCGA
ATTTGTTTGAAGATACAATCATGTTTAGCCCAGCATTTGGGACACCAGGGTCCTGTTCGC
AGGATGAACCTAGGCTAGTCTGAGGTTCTTTGATAAAGGATTGTTCTTTCCATTTGCTGT
TGATGTATGTTTTATCGCTTGCTCAAGTTTTGCTTGTTGCCGAGTTTAACTATCCTCTCG
CAACTTTTTCTGATTTGTGGAAGAGGCTGAAAATCTCGGGAGAGTGTGTGTTGTCATCAG
CTTCGTCTCTTGTTCCTACGAGATGGGAGTTAAATAACATCACGAGATTCCACAAATTTT
CGATGCATCCTTGCAAACTTTTACTTAAAAAAGTTGGAATGATTTATACCAGGGATGTGA
GTTAAATAGCAGCACGAGATTTCACAAATATTCGATGCATCCTTGCAAACTTTTACTTAG
AAAAGTTGAAAGGTTTTATATCAGGTGCATCCTGGCAAACAATTTAAAATAATCTGGAGA
AACAATTTGGAATATTCTTCTTAAAGATGATACCTGGACACATTCCGAACTTGAATGAAA
GTCAGTCACAAACACCACAAATGTTTTGCTGCATCCATTGAATTCAGTAACAAAGGCTAA
AAATTGAACTGCTGTGAAATGCAGTTACAACGCTAAAAATTTAACTGCATGAATTATTAT
GTAATAACAGTAATAGACATTTCACGTTAATCCAAAAACCGCTTGTAACTTGCTGTATTC
CTTGTCAACTAAACCCTTTTCGTGTTTGAATGTTTACAGCAATAACGAAGATATTTGTAC
TGGGTATCTTTTTTCACTTGGTACGATCTTTAATATTTGTTTGTCTTATCCCCTTAGCCC
TACATGATGAACTAAATATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved