Hordeum_vulgare Locus poly:snoU36a
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:snoU36a
Hordeum_vulgare
poly:snoU36a
chr4H
snoU36a, snoZ223, SNORD25, snoZ223, snoR64, SNORD25, snoZ101, snoZ102_R77, snoZ43
1001..1087, 1130..1225, 1789..1885, 2599..2693, 3160..3253, 3673..3769, 4359..4457, 4749..4836, 5571..5658
6657
AGCTGGTAATCACTGATATGCTCATATTGGTGACGTTATTGTTGCTGTAATCAAAGAAG
CAGTGCCCAAAATGCCTCTAGAAAGATCAGACAGAAGTAAGACGAGCTGTAATTGTACGT
ACATGTAAAGAACTCAAACATGACAACGGTATGATAATACGATATGATGACGGTTGTCAT
TGATCAAGAAGGAAATCCAAAAGGAACTCGAGTTTTTGGTGCGATCGCTCGGGAATTGAG
ACTTATGAATTTCACTAAAAGAGTCTCATGAGCTCCTGAGGTATTAAAAATACTAGTAGT
AGAGACTATGATATAGTAGGGTATCAGAATATAGATCAATTAGTAGATTGTGTTATGATA
TAGTCGGGTATCAGAATATAGATCAATTATGAATTTCACTAAAAGAGTCTCATCAAGAAG
GAAATTCATTCATACATTATGTTATACGATGCTGTCTATATTGAAGAAATTCATTGCAGA
CAAAACTTATCCATCCATAACTCTCATGGGTTAACATAATAAGAGGACAACTACATCCCC
AAAACGAAAAAAGGACACCTACACATCATGCACGCAAGCACACCACATCAAGCACGCCTC
AAAAACCGCGTCGCCACGTCCCTGAGATCCAGCTCTAACACTGATGCACATCGCCATGCC
GACCAGCAAAATTAAGCCACCACAATCAGCCGCCGGCCACTTTTTTGCGACTGACCATAT
CCTTTGTTTGGCCAATATTCCCAGCATCTGACTGCCTCTATCCCTGTCCCGGGGAGGATT
TCCCTGCAACCAAACAAATCCCGAACTTCAAAATGATCTGAAGAACCAGGATCTGCAAAC
CAGCTGACTTTACCAAATTGGTGAACAGATCAAAACAACCATAGAAGAAATCTCAAAAGC
AAAAAGCTAACAAACAGGGACATAGGAAGAACGTATTATTATACAAAAACTTAAAACATA
TTATGATATTAACATGAAAAACCAAGATACTATAATAAAGAGGACACAGAATATGGGTGG
TGATATAGCAGGATGGTCGGCAAGGCAAATAAATGCCAGTTGAGACCAAATATCAATCTT
CACCGTCCTCAAAGGAATCCATACATATAAACCAAATTAACACGTAGGGTTCTACAAGTA
AATGCAAAAAAGACAACAAAAAACTATAGTTTTGATTCACCTGAAAAGGGTGAGGATGAA
AGGTCATCAGATAGGAGCAAAAGACTATTTATTTTTCAAGTATAACCTGGGAAAACCACA
CTAAATCAACAGGCAAACCAAAACAAATTAACAGAAAAGAAAATGAGATACAGGAATAAT
GATGCCTCAGAAGGAAGGCAGTAGGTTAATGTAATCATTACTGATTTCATTGAGAAAGGT
TCACACTAATCATCATCGGCATCACACAACAAAAAAACAGAAAAACACATCAAATAAAAC
TGCAGACAAAGAAATGTAAAAGATAGGCCTCATAGAGAAGATTAGATCGTTCCACATGAA
GAGAATTCAGACATATGCTTGTCTATAGTTTAATTTAATCCTAGGCCCAAACAAACAAAA
TAAGGTCCACAGCTTCAGCAGGAGAAAGCTAAAAAAATCCATTAATTTCTGGAATCTAAC
CAGGGATGATGATCAGACTTTGTTCTGCATTTGGGCCATCATGTTGGCCAGTCAAACCAA
TAGGGAAATTAATCATTCATCATCACACTTCCACCGATTAAATAAGAAAACTATTGCATG
AAATTACTCTACATAGAATAAAACAAGGGAAACTATGACAAGGCAAAGCAAGCAAAATTC
AATTGACTCACTTAGAAACAAGAAGATGATCAGATACAGTTCAGTATTTTAGGCCATCAT
ATCAGCCAATCAAACCAATAGGGAAATAAATCTCATTCATCATCTCATCTCATTCAATAC
AAAAAATAAACTGAAAGAAAATTACTCAGTGAGGCAGGATGCATCAAAGAAATGCCTCAT
ATGCAAATTACCCATAAACTCAGGTTTCCTCATTTGCATCAACAGCCATTCAAACAACAA
AAAAGAAATTCTTAAAAATGGAAAGGCAAAATTCAGTAGAGAATGATCAGATAGAGCTAA
TACATGATTCAACGGACATCATACCGTCCTTCAATAATTATTTAATCCTCATTTCACCCA
AAATAATCAAAACAGCACAACCAAATAGTGAGAATATAATCCTGGATGCATCAGATCTCC
AAGGTGAAAAGATGGTAACATCATTGAGATGCCTCAGACGCAAATTACCCACAAAAATTG
TGACTCCTTATTTGCATCAACAATGGCCATCAAAGAAACAGCAGCAAGAACAAGACAAAA
AACTAACTGCAAGAGATACTACAACCAGAAGAAATGAATGAAAGCTTTTGCAGCAAGGCT
CAAGGTTTCAGAAAGAATTGATATCTATTCAATAAATGAAATAACTGTATGACGAAAGGT
TAGATTCGGTTCAGTATTTGAGGCCAGCATATCAGACCAATTAAACCAAAAATTAAATAT
TGTTAAACTCTTCAAATAACAGTAATAACACAAACCTAGGTAAATAAGAGAAACTGATTA
TCAAAGATGTTAAACAAACATTTTGTTGTATCAGTTAGAAAAACAGAAATCAACTTGAAA
CAACAAGCAAACTGATCCACATTTGCTCATGGTTGTCATGTGGGTACAGTGCCTCCAGAC
AAGTTCATTCCTTAAACAGCATCCTGGAGCCATCTGCACTTCTAAACATTAGCCTCTTTG
GAGAATTACACCTGGAATGACACAGATTTTATCAATTGCAATGGCTTAGATAAATATAAC
CGTTATGAGAAGAAGATCAAAACAAACACAGAATATCTAAACTAATGGAAGCTAAGATCC
AAAATATAAAGACAACTCAGTCCCTTAGATGTTCTTTGACCATGCGATCATTACCACAGG
AGTCATTACAGGTCTGTAACTGTAAAATTTGCTCATCACAGTTGTCAAAATCAAAAGCCA
AACAGAGGATCAACAAGGATTTTGTGTGTGACATGACATGTATGTAGAAGCTGCCAGTGC
CCTATGAGAGAACTCGGAGAGCACAAAAGAGGGGCAAACTCAGGATACAACAGGATGATG
TTGCTTCAAGGGAACGAGTCCATTGGGAACCGATCAGACGATCATCCCAATGACCAGATG
ACGAAGCACAAACAAAACACATGTTCAGTTGTGAAAAGTGTCCTCACATCCATTAATTTT
CAGAGGAGCAGTGCTACATGTAATTCATATATGTGAAATATGAATAAATATCTACATCAA
TTACATTTACTATGCAATTTGTGTTATGTAATCAAACGGCTCATTTTTCATTGTTTTTCA
TTCTTTCCATCAATCATGCCAATTTGTGGTACTTCACCGATGGTTTACATTGCTCAGTCA
TATGATATGACTTCTCACTGAGGCCAGAGGCATCTCTGAAGTCTGACATGCGAAAATTCA
TAATTCATCACCGCAATGCCACAAAACTAGGCAAATATGAGAAAACGTCTACAAAGACAA
TCTACAAGAAAAATGGAAGAGCAAAGATGCACTTTCGAAACAGGACATCAAAAACACAGC
ACAACTTTTGAAACAAAAAACAAGATAGAACAAATATGAAAGTTGGCAAAGAGTATTGTT
GCAACTTTTAAATACTAAGAATCAGATCATGGATCATATTGTTGCAGTATTCTCTAATCC
TTTGATGCAGGCTTAGTTTTACTAGTTAAAAAAGAATAAGTCAACTTAGAAACAGAAAGT
AAAGTTTCATTTAATCATCAACAACCTCAGATTTGTCCATCGATGTCATGTGGATACAGA
GCCCCGTAGGTTCATCCAGTAAACAGGATCATGGAGCCATCTGAAACTCCAAAAGTTGGG
TATAGTCCACATATTGTTTGTCATCCATCTCTCTGATTAGGTTCAAATATACACCCAATA
CAACTGGAATGGCTCAGATCAATATAACAGGTTTCAGTCATGAATTCTCAGAAGCAGAAC
TGGCATGTTTGCTGTAAGTGTGTTATCATCACTGCCATATCAAACCAGAAAACCCATATC
TAAAGTAAAGAGTGCACAAATAAAAACTAACATTCTTATGGCACATGTTTTCCCTTGTAT
TCATGAATTAATTTGAAAAACAGGTAAGATGGCATTGTAGAAAAATAATGCAGCTAAGCT
CTTCAAAAACTGTATTGAAAGTTGGAACCGATAGGTCGCACCAGATAATAAAGCAGAGTT
TTGGTTAGACAATTTGACTCTAGAGCAATTCCAAACAGTGCAAAGGGTTTGGTAGGTAAA
TCATCTCACTATACACACTCGCTACATAAGCATAAGGCCTGAGTCCAGCAAAAAAAATTG
TTGATATAAGGATCACACCACACTCCATTATCACCACATATTTCCTCTGTACCTTCCTAC
TGAAACAACACAACCCATTCTCTTGGTATGGTGCCTCCAGAATGACAATTCAGTAGTCAA
AACACATGTATTTTTGTCAATTCTAATTTATATCTGCTCATCAAATTCATCAAAAGAGAA
TGCAATTTAGTTCCTCAACGTCCAATCACATAACAAGAAATTCTGCGCTGGATAGCGAGA
GGAATATCTGCTTTCTGCTTACCATCTTCTCATTGCCCAAGAACCATAAAGATTAGTTTA
CAGGCAAGTACTGTCAAGAAAAGCAGATAAAAAACACAGCAATATCTAATCTGTATTTTT
TTCATCTACTGCCAGCAAAGATGCAAAATACAAAGACAACTCAGTCCCTTAGATGTTCTT
TGACCATGTGATCATTTCCACAAGAGTCATTACAGGTCTGTAACTGTAAAATTGGCTCAT
CACAGTTGTCAAAATCATAATACCAAGAAAGTGTATGTAAGAGCTGCCGAACTGACAATC
ACCACAGAGTCTGTTTCTTCAATATCTTGCAGCGGGTTCTGTGCACAGATCATTCAAAGA
GGAAATGAATCGAGTGAATCTTGTGCCGTTATTTAACTCCCATCTCATAGGAGCAAGAGA
CAAAGCTGATGACAACACACGATCTGCAAGTTTTTCAACCTCTTCCACAAATCAGAGGTA
CTTGTGAGAGAATAGTTAAACTCGACTTGTTTTATCATTTCAATAGTAGCAGAAATCAAA
TCTAAAACAGAAACAAAAGTTTCATCTGATCAGAAGAACCTCAGAATTGCCCATGAATGT
CATGTGGGTAAGGCGCCTCCAGGTAGGTTCATCCTCTAAACAGGATCCTGGAGCCATCTG
CACGTCCAAATGTTTGTAGCATCATCAGCAATTCAAATAGTGTTTCACAACAAATCATGA
CTTATCCTGATTCAGGATGCAAGGAAGAGACTACGGTAATCAATCATTAATTTTCAGTTA
CCAACGATGTGAGAAAATATAAAGAATTGAAGTGTAATGGCTCAGATATTGTATAACAGG
TTTTCAGTCATGAATTGTCAGAAGCAGAACTGGCATGTTTGCTGAAAGTGTTTATCATCA
CAGCCATGGTCAAACAAAACGCACAAACCTAAAAATTAACTTTATATTTGTATGGCTCAT
ATCAAGAAATTCAACCATGTGTTTCCCTTGTACTTCATGAGTAAATCAGAAGCGCGGGTA
AGATTCAAATCACCGCCATCAATCAAAACAAAATTCACTAAAGAGCTATGTAACGCGGGT
TCAAACAGATGGGTGGCATCAGATAATAAGCGGAGTTTTTGTAAACATATCAAAGATTCA
GCGTTTAGCATACAATATTTCACATCATTTGCCACCCTAAGCTAGTACCGATAAATTTAC
AAGGAAACAGAGAAGGATAATGCAAGGCATCAGATAATAAGCGGAGATTATTGGTCCACA
CGTGGAATTTTTCCATTGAGAGTGTAGGATATCTGTTCATCACTTGCCAGCACGAAAGAA
TAAAAAAGATTTCGAAAACTAAAAATCTCGGTTAGGCTATTTGACTCCAGAGCAATGGCA
AACGCTGCTGAGGGTTGGTAAGTAAACCATCTCACTATGCGCGCCCGCTCTGGCCCCCTC
AGATCTGAGTCTAGCAAAAAACTGAACCGCGTCTAAGAGGGAGACTATGAGCTGAGCGCA
AACATGAACAGAAGAAGAAAAATAAGAGATCGGGATCCTAATGTTTTCTCTCGGATGCCA
ACCACAGGGGCAAGCACGGATGATGCAGACTTGTCAACATGGCATCAGTTCAGACCGCCC
GTCTGCGTGTACTCTCGTCATCGAGAAAGATTTCGGACCACAGATCATCTAATCTGATCT
ATCTAAACCCACAACAAAAACTCAGAAGCAACACGAGAAACGAGGCTGAGAAACAGCGGA
TAGCACCGACGAGCGTATGCGGAGGCCGAGGCGATGGCTGCCGCGCCGCCGATGAGTGGA
GGCGGGGGCTTAGGCAGGCTGAGGCGATGGCGGCCGCGCCGCTGCGTTGGTTGGGTGGGA
GGAAAGGGGAAGCGCCTCTATATAGAGGGGAGGATGAGGAAGACAGGTTAGGTTTCGGTA
GCAACGGAAAGAAATCAACCTTATGGGCCGCCGGCCGAAACATTAGTAAGTGGGCTGCGG
AGGACAAGAGAAGCCCATCTCCAAAACTGGCCCAATTGCAACCCGCCAGCCGCGAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved