Hordeum_vulgare Locus poly:SNORD25
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:SNORD25
Hordeum_vulgare
poly:SNORD25
chr2H
SNORD25, SNORD25, snoU31b, snoU31b
1001..1089, 1199..1287, 1998..2085, 2540..2623
3622
CAAGCCACAGATCAACGACGAAACCCTCGCGCGATGACGACGGGTAGATCCAATCTAAG
TTACAGGGAGAGGGATGGGGGAAAGTGGGAGCCGAGCATTACTTGTTGGCGAGGCCCTGG
ACGAGGAACTCGTTGACGACGTAGCCCAGCGCCCTGCTGAAAATGCCGCCGCCGCCGCCG
CTCCGGTCCAGCACGGACAGCCACGCCTTCCTCCAGCCGGCCATTGTTGTCGGTCAGCGA
TCGCCGATCACTCACTCCAGTCTCCAGTGCTGTACTGGTCAGTGCGACGGTTACCAACTG
CCGGCAGGAGCGGATCTCGATGGGCAGGCTCAGAACTTATGGAAGTCCGTTGCGGACCGG
TTCGGCCCAAATCCGTTGCCGTCAACTGGGCCTAGCCCACAAGCCCACCAGATCCTTCGC
CCTAGGGTTCGTTCGCCCGCAATACCCAGCCCAGTTCGCGTATATAAAGATGATCGCGCC
GATCCACCCGAATGTCGCATCGCATCGCCATTCCAATTGACCGCCACCTTTGCGAAGTGT
CCACCATGGCGTGCGGCGGCGGCGGCGGCATTTTCAGCAGGGCGCTGGGCTACGTCGTCA
ACGAGTTCCTCGTCCAGGGCCTCGCCAACAAGTAATGCTCGGCTCCCACTTTCCCCCATC
CCTCTCCCTGTAACTTAGATTGGATCTACCCGTCGTCATCGCGCGAGGGTTTCGTCGTTG
ATCTGTGGCTTGATGTCGTTCGCGCTTCGTCATCTGGTCCTTGGGAAGATCGCTTCTCCG
GTCGGTTCCCAGCGGACTCGTTCCCTTGAAGCCACATCGTCTCGTTGTATCGTGGGCTTG
CCCCCTCTCGTGTGCTCGTCGTAGGGTTAATTACCTATGGCATAGGGCGCAGCAAGCTCT
TACATACATTGCCGGTAGTGATTTGTTCTAGCATGTAGGAACACGGTCAAATTTTATTCT
GGACCAAATCGCACAAAATCGTAGGGTTGTGCGCATGAGTACGTGACGGTGATGAGCCTT
TACAGACCTGTAATGATTCTTGCGGGCATGATCGCTTGATTCAAAGAACATCTAAGGGAC
TGAGTCGTTATAGTAAACCAATGGGGCCTAGTTCAGGTGTCATGTAAATTCTGTTACCAG
AGCTATTGGCTTAGATAGTCTTGTTATGTTTGATGGTCTTGTTGAAATGACGTGGGCATG
GCAACAATGATGAGTTCTTACAGACCTGTAATGATTCTTGCGGAAATGATCGCACAGTTC
AATGAACATCTAAGGGACTGAGTTGTCATGCAGCATTCGCATTACATCTGTGTTTTGTGT
TTTGTTCCTTATTTGCCCTACAGGTAAGGATTATTGTACATGTTATTTTTTGTCTGACTA
TATTCAAGGTTTTGTTTCTCCTTCAACAAAACGGTGAAAATATATATTTTGTCTCGTTCA
TAATTGTCTGAATTGTTATGGAGGACGGTTTAGATTTATATTTGGTCTCGTTCGTCGTAA
CTAGCATTTGTTTGCCTTGCCGACTACCCAAATTCTGAGTCCCCGTATCACATTACCTTC
TTGGTTTGCCGTTTTAGTTTGTTTGACCGATGATTAAACTAAACTAATAGACAAGCATAT
GTCTCAACTTTCTTCATGTGGAAAGCATAGTTATCAATGAGGTCAAAGCTCTGTTTCTTT
TTGTACTTCCTTTTATCGTCCTGTCGATGATTATTAAGTGCATAGTTCAGATGACCAAAC
TGTGATTACTTGAACAAAATAGTCTTTTCGTTCCTAGCTGACGGCCTTTGTCTGCCTGTT
TAATTTTGATTAAAGTCACATTTTAGAAATCATAACCTAGCTAGTTAAATTATTTTAATT
TGATCAAGTACACTGAAGAGAATGCTATGTGAGGAAATCCATGCGAGCTGTGCCACATAG
CCAAGGATTCATTTGGCTGAGTTGCCTTCAACTTCTGATGCATATAAAAATGATTTGATG
TCAGCAACTAATTTTCAAGAGGATGATGATTTTATATTTGTCGCCCCAGTCTTAGGGTCT
GCTTTGGTGGATCTGTGCTTATTGACATACTAATGAATCTGACTCTGTAAATGTTTTTTT
TTAATTGTGATTGCCTTAGCTCCTCATTAACTGGCATGAGTTTGTGTTCTGTACTTTGGA
TGAGGCTTCTGTGAGTTTTTCTTTCTTGTGATCTTGTTAAATTTTACTCTGGTGTTCAAG
AACCAAACTCTTGCATGTGCCTTATGATGTATTTTTATCTGCCTTGCTTAGATACCACAG
TTTCCTTGTTCTTGGTTTCTGTTTTTTTTTTATCTGCCTTGGTGTGCTGTTGTTTCTGAT
TAAGATATTTTTCTATCTGCTTTATTTAGATACCACTCACTCTTGCATTTTGCCGGTTTC
TACTCATGGGAACAAATCAATCCTGAAAGACAAGCTGTGGCACTTTGCCAATAATTCATT
TGGCTGCACTGATGATTTAAACTAATGCTGCTTTTAATGATTGTATGAAATATGCTTTAG
TGTCAGCAATGAATATCCAAGAGGATGATGATTTCATATTTGTCGCCCCAGTCTTAGGGT
CCGCTTTCGTGGACCTGTGCTGATTGACTTTTGAATCTGACTCTTTAAATGAAAATTTTG
ATATCCCTTTAAAATTTTGATGCTTTATGACCTGTGCTTTTGGATGAGGTGGAACTTCTT
GAGATGTTTTGTGTCCTTGTTATATTTTACTCTGATCTCTAGGAAGCACTCTTACTATCT
GCTTTGTTTAAACACCTCAATTTCCCTTGATTTCTGTTAGTTTTGTTTTACTTGCCTTGC
TGTTTATTCTAAGTAAGATGATATTATTTTACCTTGCAGCCGTGCCTTCCAGAGGTTTGC
TGTGAGCACCAACAGGACTTTCGAGAATCTCTCATCTAGAGGTAGCGTCACTACACTTGT
TTCTTATTTACGTGAATGTTGCTCATTTCATGTTTCACCAATTTTGGTTCAGTAGGTTTT
AGACTTTCTTGGCAGAACGTTACCATCACTGGTTTCTATACTGAATTTATATGTGAAGGC
ATTTTGTTTGTGATTCGAAATCTGTATACTGAATTGATTTTATATTTTCTGTTGTAAAGA
TGCAATACAACATATTTTTTAGGCTCATATTAGTGTTTCATCGTTGAATATATATGGGTT
TAATTTTAATGCGTTATTTGTGCAAATAAATCTGTTGATTTTTGGTTCTCACTCGTCAGT
TAAACAAGTCAGGGAGGAGGTGTCAGAGCAAATGAGGGATTCTCGTGGGCATGATAATGT
GAGTTAAACTAAACCTTTACGTGGTAAACTGTTGTGATTGTTATTTGAAATTCTGCAGGT
GACTGAGTAGATCTTTGTTTGCAGCGCTTCAAGCAGTGATGTCGACTCCTAGGCGTGCAT
CAAGTTGCTAACTGTACAATCCTGCTATCAGCGTTCCCGGTCATCTTTTCTTGTCCTGTT
TTTGGATGCCATCCTCAAGAGGCCTATAGAATCTGAATCCAAATGATTTTACTTTCTACG
GAGAATGTTTTTATAGAAAGAACTGTCTAGAGAGCATTATTTCCTAAATGCCATATATTA
AAGTGGGATTCTTCTACTCCCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved