Hordeum_vulgare Locus poly:SNORD24
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:SNORD24
Hordeum_vulgare
poly:SNORD24
chr6H
snoR80, SNORD24, snoZ159, snoZ159, snoZ159, snoZ159, snoR80, SNORD24
1001..1135, 1531..1617, 1934..2030, 2102..2198, 3529..3625, 3698..3794, 4247..4381, 4925..5011
6010
TCCCGCCTCCACTTTGCCTGCTGCTCCGACGACAGATGTTGGAGAGGGGAATCCTGGTG
CCTCCGCTTCGGTTAGTAGTTTAGGTTAGGTTTTTTTAGTCCTCACAGGTGCCGCTCTCA
CACGGATGATGTCACCACTTCTTTGAGTTTGTTCTCGAGATCGTTCGTGTGGACATAGTC
GATGGAACTCCCACATAGATTCCTGTTGTCTCTTTGGAACAATGAGGTTTAAGTTTCTCA
TCATATGACAAGATTTGGTGTTAGGTTGTTTAGATCTATGCAAAGGTCTGACGACGGCGT
TGCGGCATGAGGATGCTGGTCCTTAGGGGCACGTACATAGAGATTTTTTTGGTTGTCATC
GACAAGGTCAAGCCTATTATGGTAGGGGAGAGTTGAAAGTGACGAGCCGACACTCGTCCT
GACAACAGTAATGGTTGTTCGTTGGTCTTCAAATCTTAATTTAACTTTTGTTATGTTTGA
GATTCTTTATACTTCTGATGAACTTTGATAATAGATCAAATCATTTCTGCAAAAAAAATG
CCAAGTAGGAAATTCCACACGCCTAATCGTGGCCGGGCAGCGTGTACACGTGAAAAATCT
CACGCGGCAGCCCAGCAGGCGCATGCGTCGGCCCACCCCATCTGCACCCGCGAAGAAGAG
CGGAAAACCCTAGACAAATCCCCACCTCCTATTTTCTTTTTATATAAATCCCCACCAACG
CCGCCTACAATTTTCAAGCCGCAACAGCTCATCCAGCCAACCCGCATACGCATCGCTCTT
CTGATTCTTGACGAATCTCGATTCGTTCCGTTTCTTGTTCTTCATTTCGATGGTGGATGG
GTGGTCGTAGCGGTGATGACAAATTTGTGGACTAGAGTTTCTGATGCCGCCTCTTCAGCA
GCATCTGCAGACAACCCCTTGGCTGTCTGAGCTCCCAGATCTCATCCCATCGAATCGGTC
TGTTCATCCAGTTCTTTATTTTGATTGATGCTGCGTTCATTACCAATTCCTGAGGATGAT
TTGTGTTCCTCGCGGTAATTAGTCTCGGACGCTACACGCGAATCTCTGATGTGTGGTATA
TCCTGATTGGTGGCCTCCTCTGTGCCATTTTATCCTGGAAACGCCACATACATTCTCTTT
GTCTTTTGTATCTGAAAAATGTTTCGATTTTTTTTTTCAATTGATTGATATGGATGTGGA
TGATGAGATCACAAGTAAAAATACAGTTATCCCTGTCTTACTTCCTCGGAAGGATGCTGA
GAATACTTTTAATCTGACACTACTTTTAATCTGACACCATACACGTAGTGCTGCAAGAAG
AATATCTGATTTTCGTAGACATGTTGTTTTTCTTTTGGTTTGGCTTGGATGGCGAGGATG
AAGAAGAAAATCATTCGGATTCCCATTGATTTGTAAAAAAAATGAGATCTCTAACCAGCT
ACTTCTGACTCGTCATACAATCCTCCAACTGGTGGATAGCAGTCGTTTATTTTTTTATTG
TTTCAGCTGTGCTTGTTCGTGTTTTTCATGGAGCCAGTGATGTTATCAAAATATTTGCTA
CTCTTGATGGGGCAACGACCCCATTTGATGATCACAACCACCAAGATCTCTGAGGCCCTG
CAAATCATCTCCTATATTTTTGAAGATTATCCGTGCCTGCACATGAAAACTCCTCAGATG
CACCGATTCTAAACGGTGGCAACTCAGCTGCTTTGTGCTTCCCCGTGCAATGGTTGGGGC
TTGCATTGTACTGACCTGCTTCAGATTCGGTTCAGGAAACACGAGAATGCATACGAAAGA
AAAGCCAAATCCGAAACATAAGACTCGTGCAGGCAGTATGGTTTCTGGCCAAATAAGCTT
TGAGAGCTTGCATCGTTTCTTTACATGTTGTCCTTGTTGTATTATTAATCTTGTACTGGG
TATGATGTTGAAAACTGTCTGATGATGATCAAACTAAATACTTTCGTTCTTCTGATGCGT
TATCTCATGGCGCTGTGCGGAAGGAATTTGGAGACCTGAACTGAGGAGACACTTCATTTT
ATTTCTTTCCACCCTGAAACAATGGATTTAGTTGTTTATCTCATGTTTTCTGATGTTTAA
AACTTTCTGATGATGATTAATCTAAATACTTTCGTTCTTCTGATGCGCTATTTCATAGTG
CTGTGCGGAAGCAATTTGGAGACCTGAACTGAGGAAATACTAAATTTCTCAACCAAAACA
AACATTTTTTTAATTTTTTTTTCAACAACTGGTGTATGGAAATGTATTTGAGTAAGCATC
TTTTTATTTGGCGCAGCACCCGAGCGGAAAACCCCAACAAATCCTCACCTCCTACTCCCT
CTGTCTCAAAATAAGTGTCTTAACTTTATACTAGCTCTAGTACAAAGTTGTAATAAGCTT
GAGACACTTATTTTGGGATGGAGGGAGTATTTTTTTTATAAATTCCCACCAACGCTTCCT
CCAATTTCCAAGCTGCAACAGCTCATCCAGGGCCTAATCGTCCTTCTTTGGTACCTACAA
GCCAAGCATTAACCATGGTATCTATAATTGGGCCAAGAATTAGCTTTCATGCATTGATAG
GAACCTGTGACTTCATGCTTCTTATCCTCTTGATTATTGCACACCTTCTCTCTTTGCTCT
TATACTCTTGGTAATAAATTTTTCCTTGATATTGATTATAGTCACCATGAACAGACTGAT
TGGTCCGCTCTGGTGTGCCATTCTGTTAAATATGTTATTCCAACGTCCAACCCTAAAATA
ATGTAGATTCAACAACCTTGATGGTTTGTGTTTTTGTTTATGATTGTCCAGTGATGAAAA
ACCTGATAAATCATACCATCTTTCGGGACTGATTGGTCGCTATGCGTCCATGCTGTCATG
ATGCAATTCTGAGGCAAATTATGTTGAAGATCACTTACTTTTTGTTTTGAATAATGTGAC
TCTGCCCCTTGTTTAGTTGATCCTTCTGTTTTATTTCTCTGGGGCTCGAATTTCCCGAAG
GGGCTAGACTTTATGGGGATCATCAGTTGATTCACCTACTTCTAGTCGTGTGGTCTAAAC
TGCTCCTGCTTATCATTATATCTTTTATGATTTTAGTTTGCCCTTTTGTATTCAGTTCAG
TTCTGTGAGTCCAGTCATGGCACATCTTTGAGACCTGAGTTTTCTTCCTTGATGAAAATC
ATAAGCATAATCCCTGAGGGCTACCAAGTTGATCTTCTGCTATTCCTTGATTCTCTTTCT
TCACTTTTGGTCGACTATTCTTTTGTTTGATGGAGACGTATTTGCCTAGAACACATTTTC
TTACAGCCCAACAATCAATCACCATGGTACTGTCCTTCTGAAAATCTTTAATGTGGAAGA
ACTGATCCTCGTGATCACCTGTGTTGGTAAAATAAAGTGATATAATTCATGTGTTTATTA
GATATATATTATCACCTTGTTTTTGCCTCTTGATGACTGGACAAACATTTTTTGTTTCAG
CCTTGTCCTTGTTTTCTTATTAATCTGGTTCTGGGTATGATGTTGAAAACTGTCTGATGA
TGATCAAACTAAATACTTTCGTTCTTCTGATGTGTTATCTCATAGCACTGTGCGGAAGGA
ATTTGGAGACCTGAACTGAGGAGACACTTCATTTTATATTATTTCTGCCCTGAAATAATG
GATTTAGTTGTTTATCTCATGTTTTCTGATGTTGAAAACTTTCTGATGATGATTGATCTA
AATACTTTCGTTCTTCTGATGTGCTCTTTCATAGTACTGTGCGGAGGAAATTTGGAGGCC
TGAACTGAGGAAATAATTCATTTCTCACCCAAAACAAGCATTATTTTATTTTTTAAATTC
AACGACTGGTGGATGGAAATGGAATTGAGTGACCATCTTTTATTTGGCAGGCCGGGGCGC
ATCACCCGAGCGGAAAACCCTAGACAAATCCCCACCTCCTATTTTTTTTTTGTATAAAAC
CCCACCAACACTGCGTACAATTTTCAAACCGCAACAGCTCATCCAGTCAACCCGCATATG
CATCGCTCTTCTGATTCTTGATGAATCTCAATTTGGTTTGTTTCTTGTTCATTTCTATGG
TCGATGAGAGGCCGCAGCGGTGATGACAAATTTGTGGACTAGAGTTTCTGATGCCGCCTC
TTCAGCAGCATCTGCAGACAAACCCTTGGCTGTCTGAGCTCCCAGATCTCATCCCATCAG
ATCGATTTGTTCTTCTACTTCTTTGTTTTGATTGATGCGCGTTCATTACCAATTCCTGAG
GATGATTTGTGTTCCTCGCGGTAATTAGTCTCGGACGCTACACGCGATTATCTCATGTGT
GGTATATCCTGATTGGTGGCGTCCTCTGTGCCAGCTTATCCTTGAAACGCCACATACATT
CGCTTGACGTCCTCTCTTATTTCTCTCTTCCTTTCTTTGTCTTTTGGCTCTAAATGTTTC
GAATTTGATTTTTTTCCAGTCGATTGGTATGAATGTGGATGATGAGATCACAAGTAAAAT
ACAGTTATCCCTGTCTTACTTCCTTGGAAGGGTGCTGAGAATACTTTTAACCTGACACCA
TATATGTAGTGCTGCAAGAAGAATATTTGATTTTTGTAAACATATTGTTTTTCTGTTGAG
TTGGCTTGGATGGCGAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCAGCTACTTCTGACTCGACATACAATCTG
CCATCTGGTGGATTAAGGCGTTTATTTCTTTTTGTTTTAGTTGTACTTGTTCGTGTTTTT
CATGGAGCCAGTGATGTTATCAAAATATTTGCTACTCTTGATGGGGCAACGACCCCATTT
GATGATCACAACCACCAAGATCTCTGAGGCCCTGCAAATCATCTTCTATATTTTTGAAGA
TTATCCGTACCTGCACATGAAAAGTCCTCAGATGCACCGATTCTAAACGGTGGCAACTCA
GCTGCTTTGTGCTTCCCTGTGCAACGGTTGGGGCTTGCCTTGTACCGACCTGCTTCAGAT
TCGGTTCAGGAAACACGAGAATGCGTACGAAAGAAAAGCCAAATCCGAAACATAAGATTT
GTGCAGGCAGTATGGTTTCAGGCCAAATAAGCTTTGAGAGCTCGGAGTGTTTCTTTACAT
ATTAGTCTGTCGAAACAGAAGCAATGTTGTTGCCTGGAGCTGAATATTCAAATGTCAGAT
TTTTAGCCATGGCTGATCAATAACATGATGCGTGTAAGACAACCATACTGATAATCTAAC
TTGGCTGCAGAGTGATCCATTACGAATTCCTGATGATGATTTGTGTTCCTTGTATATCTT
GATTGATTGGTGGCGTTCTTGTTGACATATATTTATTTTTCTGCTGTTGGGATCTGATTT
TGGCGATAATGTTAGTTCCTTCGTGTTTGATATATGAAGATGTGGTATGTTCAACAAATG
TTAATTTTTTAATTTGTTTTCAAATCAAACTGATTAGTATGTATGTGGATGATGAGATGA
CATGTAAAAATACAGTTATCCCTGTCTTACTTCCTTGGATGGGTGCTGTGAATACTTCGA
CTGGACCCTTGCTTTTTATGTGCACTGATCTTTTCCTAGTATGTACAATATCTTTTAATA
TTGTTTAGAAGATCTTGGCCGGTGTTGAAATTTATTGATTGCTGAACCAACCATTGTTTG
GATCTGTAGTCTCTATGTGTCACATTGAATTGACTCACCAACAGTTGTAAGAGGAGACTG
AGCAGCTTCAGTGTAGTAGGTTCGATTGTGTCTGATTCCGTGAGTCCAGTGATGGCACAT
CTTTGAGACCTGAGTTTTCTACCTTGATGAAAATCATAAGCATAATCCCTGAGGGCTACC
AAGTTGATCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved