Hordeum_vulgare Locus poly:SNORD24
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:SNORD24
Hordeum_vulgare
poly:SNORD24
chr2H
SNORD24, SNORD24
1001..1086, 6720..6805
7804
TTTTTAAGACGTCGTTGATGAATTCATCATAAATCTATAATGATTTCATCCGAGATTGT
CGTAAACCGTTTGAGGGGATCAAATCTACATATAAATTACGATGATGTGAGTCAAAAATG
TCGTAGCCACATAAGATGAGATCGTCATAACTTTTACGTCGATTATAAAAATGTCGTAAC
ACTCAGAACCCTTCCCACGGATCGATGACATGGCGTCCATCCATCCATCCATCTCTCCAT
CCCATATCCATCCATCCATCTATCTACAAGGACAAAAACTGAAAAGGAGATAACCCCACC
CACAGCCCAAAACCCTAGCTCACATCCCCTATCCTGTTCTTCCTCCCTCGTCCCCATCTC
CTCGCAGCCGCAGCCGCCTCCTCCCCGTCCCCTCCCCCTCCCGATCCCCACCTCCTCCTC
ATACCCTACGAAGAGATGGGGGCGGTGACCGGAACCCGACGATGGGGGTGGCACGGCAGG
GCCTGCTGCTCGACTAGTGGCGCGGGATCCAGGAGGACCAGGAGGTGTACGACGACCACG
GCGACCCGTCCACGGCCAAGCATCGCCGCCGCCGCCTCAACCAGGCCAAGGAGCAGTGGT
ACGGCCCTCGGTTGCCCAGAGGGTTCTCCGTCACAGTGCACGTGCGCGCTGGCCTACCGC
CGGGCCATCAGGCGCGCCTGCCTCGCCGCCGCCGCCGCCGTCGTCCTCCGCGTGGTCTGC
TCCCCTCTCATCTGCACTCCTCCTCCTATTCCAATGTAGAGCCCTGGTTTCTCCGTGCTG
CCTGTGCCACTCGGATTCATCGACGCGCCCTCGCCGAGTGTTCCAGCGCGGGGGATTTTA
TTTCCCGGGTGAAGAAGAAAATCATTCAGATTCCCATTGATTTGTAAAAAAAATGAGATC
TCTAACCAGCTACTACTGACTCGTCATCCAATCTACCAACTGTTGGATTCAATAGTTTAT
TTCTTAATTGTTTTAGTGGTGCTTGTCCGTGTTTTTCATGGAGCCAGTGATGTTATCAAA
ATATTTGCTACTCTTGATGGGCAACGACCCCATTTGATGATCACAACCACCAAGATCTCT
GAGGCCCTTCAAATCATCTTTTATTTTTTTTGATGATTCTCTGTGCCTCAACATGGAAAG
TCCTCAGATGCACCAATTCTAAATGATGGCAACTCAGCTGCTTCCTGCTTCCCTGTGCAA
CGTCTGTAGCTCCCCTTGTACTGACCTGCTTCTCCATGTATTGCTGTGAAAACAATATCA
CTGTTGCTTCAAATTCGGTTCAGGAAACACGAGAATGCATATGATTTCAGTAACATGCGT
AGAGTTTTTTTTATAGCTTTGCTATGACAACAAACCCAACATCATTTTACTACCATGTGT
GGAGAATATATATAAAAGGCAAAGAAAAGCTAAATCCGAAACTTAGGTTTTGTACAGGTA
GTATAGTTTCAGGCCAATTAAGATTTGAGACCTTGGTGTGCTTCTTTTACATATAAGTCT
GACAAAACAGAAGCAATATTGTTGCCATGGCTAATCAACAACAGGATGCGTGTGAGACAA
CCATACTGATAATCTAACTTAGTTTTTATCATGTGCTGAGACTTAAAAATCACCTAATGA
GAACACCCAAGGTCATAATTCCNCATTTTTCTAAAATACTAGGACATATTTAATGTACAA
TTTACCAAATGGTTTGGTGTTAAAAGCTTTTATCCACCTCTAGTGAAAAAGACAAATTGT
CGCCGATTCAGTAGGAAGCGGGTCAAATTTGAACTGCAGCTGCATTATAATTTGTTATTT
TTTCCAAAAATTATTTATATGTACATAAGTATCTATTTAATAAGAATTACATGGTATGGT
GGCTTGACGCCGAGGTTTGGATGGTGGTCGAGGGCCCCAACTCCAGAGCGTGTGAACTTG
CATGCGAGCCGTGTGGTCACCGCGTTACCTTGCATTGCCACACATTCTGGGTGGAATAGG
CATGTCTGGTGGGTTAGACACTCCCTCGGTAGGTGTCAGGAAGAATAATACAATAGAAGA
ATCTCATGAGGAGACCGAACTAAGCTCAAACATGAATTAGCAGCCAAGTGTTTGATTAGC
GGTGCGGGTAATGCACATAGACAATGGGCCTAAATTTTGGCTGAGGATGATCATCTACTA
AGGAGACTCTCTTGCCAAAATTTTAGCTCAAATGGATGAACCTAGGTGACACTTGCTTTG
CAAAGTACCACACTGTGCAGAAATATGGATGTTGAAGCTCGGATCAAATGAATCAATGGA
TTGAGCTGAAATTTGGTGCATGATGTTAATTAGGGCATATGAAGGCACTATAAAAAATAT
ACCATTTGCACATGCCAAAGTGACACTTCCTTCACAAAGTGCTATTCTGAAAAGAATAGG
AAAATGAATATTGCTGAATTATTTTCGAACTATGGAAGGAAGGGTTTCCACATATTTGAG
GAATATATGATCCAAAGTATTTATGAGAATTTTTCGAGAATTTTTGGACTGACGGAATAG
TAGGTTGATTCACAAACTAGGCAAAAAATAACACATGGACATGACACGTAGGCAAAACTG
ATGATGTGGCACCTAGTCATAGCTATGACCATCTATATTGGTCGTAATTAGCTACAAATT
AGGCAGCGAAACAGGGCTATCTGCTTTACGACCTTTTCCAGTAAGGAAGTTACGACCTTT
CTGATGAAAAAGGTTGTTAGTTTTTGGGGTTATGACCCCTCCGGACAGCTTACGACCAAT
TGGTCTCAAATGGTCATAGATTTACGACCAATTATGCGAGTGTAACTCACAGAAGGTCGT
TAGTTGACATATTTCTTGTAGTGAGCCCTTAGTGGGTTGGTGGGACAGTCCAAGCACTAC
AAGAAATATGCTCATACATGACGTTTTTTAAGACGTCGTTGATGAATTCATCATAAATCT
ATAATGATTTCATCCGAGATTGTCGTAAACCGTTTGAGGGGATCAAATCTACATATAAAT
TACGATGATGTGAGTCAAAAATGTCGTAGCCACATAAGATGAGATCGTCATAACTTTTAC
GTCGATTATAAAAATGTCGTAACACTCAGAACCCTTCCCACGGATCGATGACATGGCGTC
CATCCATCCATCCATCTCTCCATCCCATATCCATCCATCCATCTATCTACAAGGACAAAA
ACTGAAAAGGAGATAACCCCACCCACAGCCCAAAACCCTAGCTCACATCCCCTATCCTGT
TCTTCCTCCCTCGTCCCCATCTCCTCGCAGCCGCAGCCGCCTCCTCCCCGTCCCCTCCCC
CTCCCGATCCCCACCTCCTCCTCATACCCTACGAAGAGATGGGGGCGGTGACCGGAACCC
GACGATGGGGGTGGCACGGCAGGGCCTGCTGCTCGACTAGTGGCGCGGGATCCAGGAGGA
CCAGGAGGTGTACGACGACCACGGCGACCCGTCCACGGCCAAGCATCGCCGCCGCCGCCT
CAACCAGGCCAAGGAGCAGTGGTACGGCCCTCGGTTGCCCAGAGGGTTCTCCGTCACAGT
GCACGTGCGCGCTGGCCTACCGCCGGGCCATCAGGCGCGCCTGCCCTGTCTCTTATACAC
ATCTCTGATGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCC
ATCCATCCATCTATCTACAAGGACAAAAACTGAAAAGGAGATAACCCCACCCACAGCCCA
AAACCCTAGCTCACATCCCCTATCCTGTTCTTCCTCCCTCGTCCCCATCTCCTCGCAGCC
GCAGCCGCCTCCTCCCCGTCCCCTCCCCCTCCCGATCCCCACCTCCTCCTCATACCCTAC
GAAGAGATGGGGGCGGTGACCGGAACCCGACGATGGGGGTGGCACGGCAGGGCCTGCTGC
TCGACTAGTGGCGCGGGATCCAGGAGGACCAGGAGGTGTACGACGACCACGGCGACCCGT
CCACGGCCAAGCATCGCCGCCGCCGCCTCAACCAGGCCAAGGAGCAGTGGTACGGCCCTC
GGTTGCCCAGAGGGTTCTCCGTCACAGTGCACGTGCGCGCTGGCCTACCGCCGGGCCATC
AGGCGCGCCTGCCTCGCCGCCGCCGCCGCCGTCGTCCTCCGCGTGGTCTGCTCCCCTCTC
ATCTGCACTCCTCCTCCTATTCCAATGTAGAGCCCTGGTTTCTCCGTGCTGCCTGTGCCA
CTCGGATTCATCGACGCGCCCTCGCCGAGTGTTCCAGCGCGGGGGATTTTATTTTGTTTT
TCTTTTGTTTTGGCTTGGATGGCGAGGGTGAAGAAGAAAATCATTCAGATTCCCATTGAT
TTGTAAAAAAAATGAGATCTCTAACCAGCTACTACTGACTCGTCATCCAATCTACCAACT
GTTGGATTCAATAGTTTATTTCTTAATTGTTTTAGTGGTGCTTGTCCGTGTTTTTCATGG
AGCCAGTGATGTTATCAAAATATTTGCTACTCTTGATGGGCAACGACCCCATTTGATGAT
CACAACCACCAAGATCTCTGAGGCCCTTCAAATCATCTTTTATTTTTTTTGATGATTCTC
TGTGCCTCAACATGGAAAGTCCTCAGATGCACCAATTCTAAATGATGGCAACTCAGCTGC
TTCCTGCTTCCCTGTGCAACGTCTGTAGCTCCCCTTGTACTGACCTGCTTCTCCATGTAT
TGCTGTGAAAACAATATCACTGTTGCTTCAAATTCGGTTCAGGAAACACGAGAATGCATA
TGATTTCAGTAACATGCGTAGAGTTTTTTTTATAGCTTTGCTATGACAACAAACCCAACA
TCATTTTACTACCATGTGTGGAGAATATATATAAAAGGCAAAGAAAAGCTAAATCCGAAA
CTTAGGTTTTGTACAGGTAGTATAGTTTCAGGCCAATTAAGATTTGAGACCTTGGTGTGC
TTCTTTTACATATAAGTCTGACAAAACAGAAGCAATATTGTTGCCATGGCTAATCAACAA
CAGGATGCGTGTGAGACAACCATACTGATAATCTAACTTAGTTTTTATCATGTGCTGAGA
CTTAAAAATCACCTAATGAGAACACCCAAGGTCATAATTCCATCCTGGCATCCTCCTTGT
TTTTCCAAAAAAACTTTTGGAAAACACCTAATCTGTCATATATGTTCTTCTACTTCTTTG
TTTTGATTGATTCCGTTCATTACCAATTACTGAGTATGATTTGTGTTCCTCGTGATATAT
CCTGATTGGCGGCGTTCTTGCCGACATATATGTTTTTTTCCTGCATTTGTGATCTGATTT
TGGCGACCATGTTACTTCGAATCTGACATAGATTACTTCTATTAGACCCTTGGATTCCCT
GTATGTGCACTTTTTTTCCTATTATGTACAGTATCTATTTGATTACTGAACAAACCATTG
CTTGGATCTGGACATATGTCAGATTGAATTGGCTCACAAACAATTTTGTGAAAGGAGACT
GAGCAGCTTCGACCTAGTCTCAGATCAGTCTAGGTGCCCTCTGTTCTCCAATGCCCTTGT
TACTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved