Hordeum_vulgare Locus poly:snoR86
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:snoR86
Hordeum_vulgare
poly:snoR86
chr4H
snoR86, snoR86, snoR86, snoR86, snoR86, snoZ266
1001..1121, 1176..1295, 1377..1496, 1572..1690, 1768..1887, 1963..2056
3055
GCCCAGAGGAAACCCTAGCAGAGTGTAGCCGCTATATAAGGCGGCGCACCCCCGCAGCT
CCATTCGCGCCGCCACCAGCCCAAGATGCAGATCTTCGTCAAGACCCTGACGGGCAAGAC
CATCACCCTCGAGGTCGAGAGCAGCGACACCATCGACAATGTCAAGGCCAAGATCCAGGA
CAAGGAGGGTGAGTTTGAGCCTGAGCTCTTCTTTGTTCGCTGCCATGGCCGGCCGTCCGT
CGAGCGTTTCTTGATTCTTACTTTTGTGTTGCGGTCGTGCGTGCAGGTATCCCGCCGGAC
CAGCAGCGGCTGATCTTCGCCGGGAAGCAGCTGGAGGACGGGCGCACGCTGGCCGACTAC
AACATCCAGAAGGAGTCGACGCTGCACCTCGTGCTCCGCCTCCGCGGCGGCATCATCGAG
CCCTCGCTCCAGGCCCTCGCCCGCAAGTACAACCAGGAGAAGATGATCTGCCGCAAGTAA
TTTTCTTTTCCATCCCCTCCTCCGCCCACCTTTCCTCCTTCTTCATTCAGGCCGTGCTCG
TTCGTTCGTTTATAGATGAATGATGGGATTCGTAGTTGATCGAGGAATCGTTGGTTGATG
ATTTGATGACCCACCCGCCTATACTTTGTCATCTGCCTAGTCCAATCCAGCAGGTGATTT
TCAATGGCGGGAAGATTTGACACCACCCGCCTATACTTTGTCTCCTGCCTCGCACGCTTC
AGCAGCTGATTTTCAACGGCGGGGAAATGAAATTCACACTCTTTACTACTCCCTCTGTTC
CTAAATATGAGTCTTTCTAGAGGTTCAACTAATAAACTACATACGGATGTATATAGACAT
ACTTTAGAGTATAGATTCATTCATTTTGTTCCGTATGTAGACACCTATTAAAATATCTTA
GAAGAGAATGAAATTCACCGTCTGAGTAGTTTGTTTGCTGGACTAGATTGTTGGGCACAT
AGGTTGGAAGTTTTTGAAATGGATAGGATAGCCAATTTGCAGAGCAAAGGGGCCGGATAT
AGTGGCGAATCTTTGCATTGAAGGTTGGCGACACAGTATGCAGTTCTCCGTGCCGCTCAG
ACTTTGCTCTGCTGTGACGGCCTCGAACAATCTGCTACATCATAAACATACCATAGAATT
TTTTGGAAATTTAGGAAATGGATTAGCCAATTTGCAGAGCAAAGGGGCCTGATTAAGTGG
CGAATCTTTGCATTGAAGGTTGGCGATACAGAGTGCAGTTCTCCGTGCCACTCAGACTCG
CTCTGCTGTGATGGCCTCGAACAATCTGCTACATAACAAACAAATCTAAAGAAATTATGA
GTCAATCAACCATTAGTTTAGTCTGGAAATTTTAGGAAAGTATTTAGCCAATTTGCAGAG
CAAAGGGGCCTGATTGAATGGCGAATCTTTGCATTGAAGGTTGGCGATAGTGATTGCAGT
TCTCCGTGCCTCTCAGACTCCCTTTGCTGTGATGGCCTCGAACAATCTGCCACATAACGC
ATCAATCTAGGAAAACTATTTAGTCATTTAAATGTTGCTTGGAATATGTTGGAAGTAGAT
AGCCAATTTGCAGAGCAAAGGGGCCTGATAAGTGGTTAATCTTTGCATTGAAGGTTGGCA
ATAACAAATGCAGTTCTCCGTGCCGCTCAGACTTGCTCTGCTGTGACGGCCTCGAACAAT
CTGCTACATAACAAACCAATCTAAATAAATTAGAAGTGAAAATCAAACGTTAGTTTGGAA
ATATAGGAAATTATTTAGCCAATTTGCAGAGCAAAGGGGCCTGATAAAGTGGCGAATCTT
TGCATTGAAGGTTGGCGATAACAAATGCAGTTCTCCGTGCCGCTCAGATTTTCAGTGCTA
TGACGGCCTCGAACAATCTGCTACACCTTAACTAAATCCATGAAATCTGTGTTAAGTACA
AGTGTTGGTTGCTCTTCATCTATGTATGGTATTGAAAAATGTTGATTGGCTGGGATGATG
ATCCAATTAGATGTACGAGGGGTCACCTTATGAGCTACGACCATTTGAGGCATAATTTTT
TTCTGACCAGCCAATCTTGTTGTAACTTGTTCCGATTGAATTCTTTTGTTTCTTGCAATT
ATTTTTTGTCACGTACTTGTCCCTGTATACATTTGTCACTAGTCATAATAGCCTGGTAAT
CATTTTTGATCTTGTCATATAAGCTAAATTTCACTTAAATCTTTCTCCAGGTGCTACGCT
AGGCTGCATCCAAGGGCTGTCAACTGCCGCAAGAAGAAGTGTGGCCACAGCAACCAGCTG
AGGCCCAAGAAGAAGATCAAGAACTAGGCTGATTGTTGCTTTCGTTGTCTGGATAAATCA
GTAGACATAAAAATATTTTCCGGTTATCGTTTTGCTGCTCCTCAGGATGTTGAACCTTGG
TTACTCTAGATGAGTACTTGGCCTTGTTTTAATGTCATGACATAGTGTGTCTGTTGCTGG
TAATGTTCATGGTTACTTGTATGATTGTGCACCCTACACGTTCGGATTTTGGTCTTTTGT
TGCTCTGCCACCACAATGTTAGCAAATTTGTGGGCCTGTTTTCAGAAATTCAGAACAGCT
TCGCTGAATTTAAACCAGGATTCTGAAAAATTGGGACTGACCTTGGTGTGTCTGTCTGTA
AATTGTGCTTCCAATCCAAAACGCAGTGTTAAATTTTTGATTTCCTCAAAGTAGAACTTT
ATGACTTTCAAGCTTCATTCAAATTTTAGAAATTAGAGCCTTTTTTGATTCAGACAAGTT
CTGGTCATATGGTCAATTGATTCAACAGCTTGTGAGGGACTAGTGAACATTTACATTGTA
CCCTGCAACTTAACCTGTTGGCCGACAGCTGCTGCTCATTACATGAGCACGAATGTGTCT
GGAACGAAAACAAAAATCTATCACAGCACAAACTGATAAAATTTCTTCATACCCGGCTCA
GATACCTTGTCTCATGGCTTAGGGATTTGACAATTGAGAAGATTTGAAAAGATTGGGTGG
AAGTAAGGGATTCACCCAATCCCCCTCCACAATCCTCCTCCCCTCCACACAACCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved