Hordeum_vulgare Locus poly:snoR41
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:snoR41
Hordeum_vulgare
poly:snoR41
chr1H
snoR41, snoZ155
1001..1105, 1214..1293
2292
TCAAAAAAGAGACGACAAGGAGATGGATCCCGCAAAAAACAAAGACAAGATGGGAGCAA
ACAGAGAGAGGAAGGCAGGACCAATGCCCTTTTTAAGGAAAACGTTTAGGAACGACGCAC
CGACCGAACCTTTTCGCCGGTCTTGTCCACGCATGATCCGTGCGACCCATTCGAAGGCAA
CCACGTGGATACGGTGGACCCGTGCGAGATTCCATTCCTTTTTCTTCTTCCCCGTTGCTC
ATCCCCTTTCTTCTTCCCCCGCACCAAAATTTAGGCAGTGCGGTCGCATCGAATCGCCGA
TCCCCGCCACTGCCGGCCGTCCTCGTCGCCGGTCCCCACCCTCGCCGTTCGTCCTCATCG
CCGTTTGCAGCAGCAAACATTGTGGATAAAAAGCTTCAACCGTGACAGGAAAAAGCTTCA
ACCGGCGAAAAGCTTCAACTGGTGCGCGGCAATGTTTCAACCCTTTTGAAAAAAAGCTTC
ATTGGCCATGGAAAAAAGCTTCAACCGTCAACATGAAGGGGGCTGCGCGTTGGACGAGGA
CGACCGACGAGGTGCTCGCGTTCATTGGCTGAAGGTTGGAGATGAGGAGATCCAACGGTT
AAGGGCGTCCAAATCTGACGGTCAGGATGCGACTGGCGGAATCGTTCGTGCGGGCGTCGG
CGCACAGCGATGCCTGTTATTTACATTGTTTTTTTCTTTCTTTTTAGCGGATAGAATGGG
CCTTCATAAAGCAGAAGGTGAAGCCCAAATAGGCCGTAACCATCCAAACCCTCCCGGCCT
CCCGAAACCCTAGCCCACCAGTCTCACCTATATATACATAGGCTGAAGGTTCCTAAGCTC
AAAACCTAACCTATCGACCGACCAACTTCATCCCCTGGCGGCGCCGCCGTCCCCTCCCCC
TCTAGCTCTAAGCATCTCTTCTCGTAGCTCCCCTGAGCTGCAATTTCGCTTGTTTTTTGC
TCGTAGTTTCGCTCTTGCCTTTTATTCTTGTCTCAATCTTGTCGGCGGCTGTGATGCGCA
ACGGTAAAGGGATTTTCTGAGGGACGGGAACTTAGTTTCCCTCCTCCTGATTGAGAGAAA
CCAATGGATCCTTCTGAGCCTGCCAAATACGCTAATTTTCTACTGAGCCTGTACCATTTC
TTTTATGCTTTTCGGTTCCCCCCTCTTGAGGTTTTCTTGTATCTCGCTTCGAAGACGATT
TTATTCTTTGCTTCGGTTGAGGTGAGGATAAACCTTTACAGAAACTTTACCGTGGTGTTG
ACCAAAATACAGACTACAATTATCTGATCAACCGAGAAAGTTTGTTATTGCTTCTGTTTG
CATCTTTTTTTTTCTATTGTGAATCTGTGCCGTGCACAACAAGCCGATGCTCTGGATCGA
GGGAGGAAGGAAGCATGGTAATGTGCACGGAGAGTACCGGTATCTGTGGTCTGCATATGT
CTGCTCGTCTTGACGCCTTCGGGCTTTGATCTCGCGGGCCTGGATTTGACCAACAATCCT
TTCCTTGTTGATTTCTCCAGGGGAGGAATTTGTTTGCTTGGTGCTCATGGGATAATGTCT
TTGGGAACGATTGTGCTTGTTTGGTGGCATCGCAATTGTAGTGATCGAAAATGACTCGTA
TATAACTGTATAAAGGAAGATTGTATTTATGTCCAACAACAAACTTAAAACAAGATAAAG
GTTGCTTGCAGCGTTCACTACATTCTTGTTAAAATAAAAATATCTAGGATCACGATGGAG
AACTTCATAAGAAATGATTAAAATGAAAATATCTAGGATCATGATGGAAAGCTTCATAAG
AAATGATTTAAATGAAACGGAGGTTTCATAATGATAGCTTCCCAGGACTGCGGAGCTGGG
AGCCCAAAGCTGCAACGGCAAAATTGCTGCACACCGATGTATTTGGATGCTTGAAATGGT
GCTATAGCTGATGTACCCATCATTACCGGAGGCCCTTCATGTGCTAGCCGTAAGGGAGTG
CTCAGGCGGCAAAAGTTGGGCAAGTTGCTGGCTAAGCTGTCTGCAAATAGTTGTGATGGA
TGTTTTTTTTGTGTGGGGAAAAGAGAATCTAGAGAGAAATACTCAACATTTTCTTGTTGT
ATATGAATACTGTCGTAGTGTTATTAGAACAGTGCTTACTACAGATAAGGGAGTGGCGTT
TTGGATCTCGTGGCTTATTTTTTTTGAAAATTAGAAATTCGAAATTGTCAGTCCTAATGT
TGCTGGCATACACTTCAAAAATTGTCAAGTAAGGATGTGAACAGGTGGGGGCTGTTGCGG
ACATTGATGCTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved