Hordeum_vulgare Locus poly:9:SNORD14
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:9:SNORD14
Hordeum_vulgare
poly:9:SNORD14
chrUn
SNORD14, snoZ43, snosnR60_Z15
1001..1125, 1368..1470, 1727..1821
2820
AAAATTTAAAATAAGAGAAAGATAGAGAAGAAAATTTTGAAATTATCAAAAGAACTTAA
AAAGATCAACCACATACGTCATGCAGATCTTGCGATCGTATAGCACCGGTCGAAGCCGGA
TAGCGATACGTCGATCTTTTACCTCCGCAGACCCGATGGACCAGCGCTAACTGATTCGTG
ACCGCATCGTCAGTGATCACAGGGTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCGGCGTGCT
AAACGCGCGCTGGGCCACCCTCGTCCGCGGCCCATTAGCTAAACGGGTGATTTTCTCATT
GACAACGAGCTCGTCCTGATCCCCTTCCCACGCAGGCACAACGCCTCGCCGAAGCGGAAG
AGATCGATCCCCGCCTCCTCCGCCTCCTCTCCGGCAGGTGCCCGCCGCATCTTCCGCCTC
GTCTCCGGTGCGCCTTCTCTCCGGCAGGTGCTCTCCACGTCTCCACGCCCTCCATTCTCG
GCACCTCTTCTGCTCCTCCACCCTCTTCGCCTTCTCTCCGGCCAAGCGGGTGCTCTTTCT
GGAGGTGGTTGACTCCCCGCCGAGGGAGGGCAAGAGCTTCTCCTGCCAGCCAGTGTACAA
GGAAATGGAGGTTCTCAAGTCTGCGAGGCGTGTATCCATCGATTGCACCGACATGTTTGT
CCTGGACAGCGAGAGGAGCAAGAGGAAGCAGACAGCTGCACAGTTTTGAGCCAACTCTGT
CACCGCACAAAATACTTAGATAAACACATCTGATACGAACCTGTGGCTGTAATTTGCGAT
TACAAATTCCTTTGCATGCTTAACCATAGTGTAGGAGTTGTTGTTGGTGATGATAGAAAA
CTTAGGCTTGTTTCTCAAAACGTCTGCGGTTGCCGCCTAAATTGATTTCGTCCTTCCACG
CTTGAGGTCTAATGCTGCTAATTCCTTTCTTGGGTGTCTGAGGCATGCTGATTTTACTCA
TTTGATCCTTCTTTGTCTCTGCTTTATCGTTATGGTGTGAGGATATTTCTGTGATATACT
TGCTTTGTGAGCATATTTAATCCGGACCTAATTTCTGATCCTTGGAATTTTTTAAACTGA
ACTATTCCCAAAATGATTGAGAAAATTGGACGCCATTTGGTTTGTAAGATAACTATTTGA
AATAATTGGACACCATTTGAGAAAATTGGACCATTTGATTTTTTGAGAGGACAGTAAAGA
TTGATATTTGGCCAGGTTCGTAGTAACTGGCATTTGTTTGCCTTGCCGACCATACTGCTA
GTGCTATATGATCACCTATATTCCGAGTCCTCTAAATTAATTTGTTTGATGTTTGGTGGC
TGATGTCTCATTTGTTTTGTGTGTAAGATCAATATGGTCGGCGATCCATATTTTTACGTT
ATAAAATTGTTGCTTCTTACCTATGAGTTGTGAACTTTATTGCCAACAGTGTTTGATCAA
TCTTATGAGAAGCTCATGCAACGTCTGGGGATGAATAAGGAAAGGAAAAAAAATGTTGTC
TTCTAAAAGGAAACATTTTTTTATTTGCTATTTTAATTTTGTTCTTGTAATGCCAGATGA
TGATTACAAGTGCATAGTTCAGATGATCAAACCATGACTACTTGAACAAATAGTCTTTCG
GTCCTATAGCTGACGGCAATTACAACAACTTTTGATCCAACTATTCGTATGTAGTCTCAT
GTTCATTTTTGTTCGACCATTACACTTATGATTCTAATATTCCTAGTCACATTCTTATTC
CTGGGGATGGCCTATGTCCGCTCCGTGGGACGGAGGAAGACTCGAATCACATCTTTTTCT
CTTGCGTATCCATGAAATTCCTCTAGAGTTGTTTTCGCAAAGTGGTCGGCGGATATTGGT
CTGACAACAATTTCCCTGACCTCTTCGCCGAACTCTAGGCTTTGCCTCGGAATCTCGCCC
CACTCGGTGACTGACTATTGGGGTGCTTGTCTGTATACTATGGACGATTCGGAATAAGCT
TGTGATTCAACGTTTACCTCTGCGACATGCTACTGATGCGGTCTTCTAAATGTGTGGCTT
TATGCAGCTTTGGCGACCGCTTAGCCGTCCGCGAGACCATGACGTCGTCAACAACATCAT
TGCCCATCTTCGGGCGTTGGCTCTCCGCTTGGCGCCGCCGCCTCCTCCTCCACTACCTAT
CTATAAAGTTTATGCAGCTTGTTCGGCGCCGCTATATTTTTCTGTTTCTTTGGGCTTGTT
AAGCTGTGCCCTCAGCAGAACCTTTGTACCTTGTGTTTGTGCTACTTGCGTGCGCCGTGC
GTGTGTGTGTATGTGTGTTTGTCTTGTGGTTATTGTTGGACATTATGCTTTGGTGGTTTG
TTTCTTTACCTTACTAATAAAGCAAATAGTGCTTCTTCCGTACGTCATCCAAATTGCCCT
TAAAATTGACTAAAATTACCCACCGATGCCACCTATAAGTCATAAAAAACGTTTCAAANT
TTGGGCAGGCCCATGCGTGGGCGCCTGTTTTTTTAGTTTAGTTTTTTTATTTTTCTTTTC
AGTTCCATTTTGTTTTTCTACTTTAAATAATTTAGAACTTCAAACAACTTTTCTCAATTT
TAAGAAACTGAGAATTTCGAAATAAAATATCCAAAAAAACATATTTTTTGAGAATTCAAA
A
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved