Hordeum_vulgare Locus poly:9:SNOR75
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:9:SNOR75
Hordeum_vulgare
poly:9:SNOR75
chr5H
SNOR75, SNOR75
1001..1088, 1172..1259
2258
TCGCAAAGTGCACTTGTAGTTTTTTTTATTGAGATGGAGTTTTTTTAATTTAGATGGAG
TATTATTACTAGTAGATTTTTTTGTATTTAATCTTTTCAATGGACAGCGCACTTCGGCCC
ATAGCACAGCATCTTAGCCCGGCCCAGTTCACCTGTTCGGCGAGTCCTCCTCCGTGCAAA
CCCTAGCCGCCGCCGGCTATAAAAGGAATCCTCCTGCACCTCCGATAGGCACTCAAAGCC
AACCGCGTCTCTCCCAGGGCAGTAGAGCAGGGTTCTTCTCCCCATTTTCATTCGAGTTCG
TTGTTGTTTTTTTGCTTTCTCTTCGATTAGATGCATTTCTCCGGGTTTGAAATGAGGAAA
ACCAATCCATAACCAAATCTCTGCATCTAACAGATGATGAGAAACAACATGCACTACCAT
CTGATCTCACCTGGTATTCTTCTCCCCATCTTGCTTCGTTTTTCTTTCGTTCTCTTTGAT
TCGAGGCATTTCTATGGGGATTGAAATGAGGATAAACCAATCCATAACCAAATCTCTGCA
TCTACAGATGATGAGAAACAACATGCACTACCATCTGATCTCACCCCCCTTCCGCCTCCT
GTTTTCTTGATCTCCTTTTAATTCTTTTATGTTTTTATTAATTGGTTGCAATCGGTGATG
TAATCGTTTAACTATGCTGAGTTCCTCTGTGATTATCTCAACAACAATCACCATCTTTCG
ACTGAGATTGCAATTATTTTCTTCTCCTCTGATCTAGTTTTGTAAATTTCCCATCTTTCG
TTGACTGCTTTATATTATCTGTGATTTGATTTCTACGGTAGGACGAATGCCATGAGGTAT
CTGATGCTTGGTCTCTTTCAATGGCCTTGTTTCTCGTTAGATTGGCAGAGAGCGAGAAGG
AAACGGGTTTTTGCGACACTGGCTGCTCCCACACCAGGAGCTTCTTGTTACTATACCCCC
GTTTACATTCGTTCATTTTTGTAAATTGTTTTTTGTTTTGTTCTCGGTGATGATCAACAC
TGATTAGATGTCCGATACAATCCATTCCTTAAACCATGGGGACAATACGAGGCATTTGTC
TGAGAGAACGTCAGATGTTTATCACTTTTTTGTTCAGCAGCTGCTGTTTCAGTTTTCTTT
CATACCTCCCCTTGTTTTTGGTAGCTCTTGGTTCCCTGTGATGATGAAAACAGATGACGA
GTCTGATGTAATCCATTCTATTACACCGTGTGGACAATCGAGGCATTTGTCTGAGGGAAC
GTTTGCTTTTTCTTTTTTCTCTTTAGTTACTCTCGTATGATTTGCGTCTCTGGCATAATG
AGGAAAACAATTGTTGTCTGACCTATTTGATGATATAATCCTCCTACTCATTCTGAATGT
CAAGTAACAGCAAATGCTAATACTATTTTCCTTTGCTTCCTTTGTTCCTCCTGGCTAGAT
TTATTGGTGTATTGAATCTCCTTGTTTGATGAATAACTAGTGTAGCTTGTAGCGACATAT
TGCTTTTGCTCAGTTTTTACCTGAATCTTATGGCAAAAGTTGTGGTTGCTTGAGCTGAGA
ACCTATTCTGGAACATGTTGAAAATTATTGACTGAAATATAATAAAACTGAACACCAACG
TTTTCGTCCAGCAAGATTACCTTCCAAAAGTAAGGGGCAAAGAACATAACGAAGGAAATA
GCAGATGAGGACTTCGCATTCCTCAGTGCAAGCAATATATGAGTCCCAATATGCAGGTGT
CGAGTTTGGAGATCACTATTTCTGGACCATGAATCCGCAGTTGTGGTTGCTTTAGCAATA
TATGGACCACGATATCACGGGGGCCGGAAGGATTTAATTGAGGTGTTGTGCCCGATAACG
TGATTCCAGAGTATTAAAAACCGAAGATCTGAATTTTACTCTGATTGGTTCAGTTTCTGT
ACAGTGTCTACATTCAAGAGGTTGTGTTGTTATACAATAATCCATCAGACAAAGCATAAG
GAACAATTTGCACACTGTTTGGAAGCTATTTTCTCCTATCAAAGATAATTTAGAATGGGG
GCATGCAGATGATTCACATCTACAACAAAACTTAGAAATGTGCACAAGGAAACGGCTAGC
TCTCAATCATGTAGGTTAAGCTCCCAAACATACAGGGAAAGCGCTATCAAACCTGTAGCT
CTCTGAATAATAAGATGATCATGAACGGATGCCCAAAGAGAGCGCTAATGTGAGGAGGTA
CTATACCTGTTTTATAAAAGTTTGATCACCAATTGAGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved