Hordeum_vulgare Locus poly:8:snosnR60_Z15
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:8:snosnR60_Z15
Hordeum_vulgare
poly:8:snosnR60_Z15
chr7H
SNORD14, snoZ43, snosnR60_Z15
1001..1125, 1500..1602, 1860..1954
2953
TCGACGAGCTTAGCATGTACAGACATGACCTCGAATACAAGAGACCGAAAGGTCGAACA
TGAGTCGTATGGTTGAATACGATCAGCATGAAGTTGCTCACCATGGTGACTAGTCCGTCT
CACGTGATGATCGGACACGGGTTAGTCAACATGGATCATGTATCACTTGGATGACTAGAG
GGATGTCGATTTAAGTGGGAGTTCATACTTAATTTGATTAAATGAACTTAATTGTCATGA
ACTTAGTCTAAAAGTTGTCTTTATAAATATTGTAGATGTCCAACGTCAACCTCAACTTCA
ACGCATTCCTAGAGAAAAACAAGCTGAAAGATGATGGTAGCAACTATGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTTCTCATTGACAACGAGCTCGTCCTGATC
CCCTTCCCACGCAGGCACAACGCCTCGCCGAAGCGGAAGAGATCGATCCCCGCCTCCTCC
GCCTCCTCTCCGGCAGGTGCCCGCCGCATCTTCCGCCTCGTCTCCGGTGCGCCTTCTCTC
CGGCAGGTGCTCTCCACGTCTCCACGCCCTCCATTCTCGGCACCTCCTCTGCTCCTCCAC
CCTCTTCGCCTTCTCTCCGGCCAAGCGGGTGCTCTTTCTGGAGGTGGTTGACTCCCCGCC
GAGGGAGGGCAAGAGCTTCTCCTGCCAGCCAGTGTACAAGGAAATGGAGGTTCTCAGGTC
TGCGAGGCGTGTCTCCATCGATTGCACCGACATGTTTGTCCTCGACAGCGAGAGGAGCAA
GAGGAAGCAGACAGCTGCACAGTTTTGAGCCAACTCTGTCACCACACAAAATACTTAGAT
AAACACATCTGATACGAACCTGTGGCTGTAATTCGCCAGTACACAGCTGCTTTTTGCGAT
TACAAACTCCTTTGCATGCTTAACCATAGTGTAGGAGTTGCTGTTGGTGATGATAGAAAA
CTTAGGCTTGTTTCTCAAAACGTCTGCAGTTGCCGCCTAAATTGATTTCGTCCTTCCAGG
CTTGAGGTCTAATGCTGCTAATTCCTTTCTTGGGTGTCTGAGGCATGTTGATTTTACTCA
TTTGAATCCTTCTTTGTCTCTGCTTTATCATTATGGTGTGAGGATATTTTTGTGATATAC
TTGCTTTGCGAGCATATTTAATCCGGACCTAATTTCTGATCCTTGGAATTTTTTAAACTG
AACTATTCCCAAAATGATTGAGAAAATTGGACACCATTTGGTTTGTAAGATAACTATTTG
AAATAATTCACTTTTAGAGTTCATAACCATCAGATTTGGAACTAACTCATTACATGTACA
AAGTACTGATGAAAGGCTTCTTACATCACAAATGAAATATTTTAACCCTCATGGGTGTTA
AGATGAATGTGGTTCGTCCATTATTATCTTGATTCAAGAGGACCATTTGATTTTTTGAGA
GGACGGTAAAGATTGATATTTGGCCAGGTTCGTAGTAACTGGCATTTGTTTGCCTTGCCG
ACCATACTGCTAGTGCTATATCATCACCTATATTCCGAGTCCTCTAAATTAATTTGTTTG
ATGTTTGGTGGCTGATGACTCATTTGTTTTCCGTGTAAAACCAATATGGTCGGCGATCCA
TATTTTTACGTTATAAAATTGTTGCTTCTTACCTATGAGTTGTGAACTTTATTGCCAACA
GTGTTTGATCAATCTTATGAGAAGCTCATGCAACGTCTGGGGATGAATAAGGAAAGGAAA
AAAAAATGCTGTCTTCTAAAAGGAAACATTTTTTTATTTGCTATTTTAATTTTGTTCTTG
TAATGCCAGATGATGATTACAAGTGCATAGTTCAGATGATCAAACCATGATTACTTGAAC
AAATAGTCTTTCGCTCCTATAGCTGACGGCAATTACAACAACTTTTGATCCAACTATTCG
TATGTAGTCTCATGTTCATTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTTCTCATGACGTTCACATATGCTTGCCCTCTGTTTTGACATGACATACAATGGGTCT
ATTGAGGATAGTTTTTCCCAGGATGCCATTTTGAAACATGAGATGTGATCCCGAGCCAAC
TTAGTTCAACTTGTTAGTTCATTCTAAAATTTTACAAAAATACCTAATGCCACGAGCTAA
ATTTAAATGTAAATTAAAATAAATAATATTGTAAACAAATTTAAATAAGTTGTCGAGCTG
ACAAATTCAGACTAACACAAGCAAAACATGCTTGTTTGGGTTAGGCGAGACAGGAATGGT
ACCTTGTCAATACCTTCCCTTCCCAATCGTGGCGAGCTCCAAACCCTAGCTTGCCAACTC
CAACACCGCTCCTTTTCGGTCTCATATCATTTATAGCCAGCCTACCACCAATGCTCATGT
GTTTGCAGTAGAAAAAACTATGGCATGTATCAATAATTATACGACGCAAAACACATCACA
GTTCACTAAAATTATATGGGCAAAATATACCATGTATAGCAATTGACATTATAAAATAAA
TTTGAGTTTGCGTGGTATTTGAGATTTTACCTCTCGTGTTTCCCACTCAGTTGGCTTCTG
ACACCCTTATCTTCCCATTGGTATTAAATCACTGGGTTATGACGTGAATCCCTGAAAACA
CAAAATTATACTATTTAAATATGTAACATTTGTCTTATAAAGTTTTCATCTGATTATGGA
TCAAATATATGCACTGCATAGATACACAAAGAGTGGTCAAATTCTTATTGTGGAATTCGG
ATCAAAATAAACTTCTTTGGTTTCTCAAAAAGAAACAAACTTGCTTCCAATCGGAGAATT
ACCTGTGCACATGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved