Hordeum_vulgare Locus poly:7:snosnR60_Z15
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:7:snosnR60_Z15
Hordeum_vulgare
poly:7:snosnR60_Z15
chr7H
SNORD14, snoZ43, SNORD14, snosnR60_Z15
1001..1125, 1651..1747, 1792..1907, 8386..8480
9479
TATGTTAAATTTGGAGTTACGGTTTAAAAGATATGAATATTTTAAAAAACATTTAATAT
ATACTACGAGTTTAATGTCATAAACAGTAAGGGTTTTTTATAAAATCACCTTGATGGGTT
TTTCGATGGAAACGATAGCCTCTTTATTATTAAGGTAAAGATTTAAGATAAGAGAAAGAT
AGAGAAGAAAAATTTGAAATTATCAAAAGAACTTAAAAAGATCAACCACATACGTCTATA
GCGATTGTATAGCACCGGTAGAAGACAGATAGTGATACGTCGATCTTTTACCTCCACAAA
TCCGATGGACCAGTGCTAACTGATTCGTGACCAAATCATCGGTGATGATAGGATAAGTAC
AAGAGTATTTAAACAGGAAAGCTGCCACCCAAGCTGGCGGTGTGGTACTAAACAAGGTTC
GTGCCGCGTGCTAAACGCGCGCTGGGCCACCCTCGTCCTCGCCGACAAGAAGCGGAAGAG
ATCGAACCCCAGGGCCGCTGCTCGGCTCCTCCGCCTCCTCTCCGGCAGGTGCCCGCCGCA
TCTTCCGCCTCCTCTCCGGTGCGCCTTCTCCCCGGCAGGTGCTCTCCACGTCTCCACGCC
CTCCATTCTCGGCACCTCTTCTGCTCCTCCACCCTCTTCGCCTTCTCTCCGGCCAAGCGG
GTGCTCTTTCTGGAGGTGGTTGACTCCCCGCCGAGGGAGGGCAAGAGCTTCTCCTGCCAG
CCAGTGTACAAGGAAATGTTTGTCAGGAAATGTTTCTCCTGCCAGCCAGTGTACAAGAGG
TTCTCAGGTCTGCGAGGCGTGTATCCATCTATTGCACCGACATGTTTGTCCTGGACAGCG
AGAGGAGCAGACAGCTGCACCGTTTTGAGCAAACTCTGTCACCGCACAAAATACTTAGAT
AAACACATCTGATACGAACCTGTGGCTGTAATTCGCCAGTACACAGCTGCTTTTTGCGAT
TACAAATTCCTTTGCATGCTTAACCATAGTGTAGGAGTTGCTGTTGGTGATGATAGAAAA
CTTAGGCTTGTTTCTCAAAACGACTGCAGTTGCCGCCTAAATTGATTTCGTCCTTCCAGG
CTTGAGGTCTAATGCTGCTAATTCCTTTCTTGGGTGTCTGAGGCATGTTGATTTTACTCA
TTTTAATCTTTCTTTGTCTCTGCTTTATCGTTATGGTGTGAGGATATTTCTGTGATATAC
TTGCTTTGCGAGCATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNACCATCAGATTTGGAAAGTACTGATGAAAGGTTTTTTACACC
ACGAATGAAATATTTGGTGTTAAGATGAGTGTCTTTCGTCCATTATTATCTTGATTCAAG
AAGACCATAAGGTGGCTTTGATTTTTTGAGAGGACAGCGAAGATTGATATTTGGTCTGGT
TCGTAGTAACTGGCATTTGTTTGCCTTGCCGACTATACTGCTACATCACCACCCATATTC
TGAGTACTCCAAATTCATTTGTTTGATGTTTGGTGGCTGACGTCTCATTTTATTTCTGTG
TAAACCAATATCGTTTCTCAAAACATTTGCAGTTGCCGCCTAAGTGCTTTCTCCCTGTCA
GGCTTGAGATTTAATGCTGCTAATTCCTTTCTTGGATGTCTGAGGCATGCTGTTTCTACT
CATTTGAATCTTTTTTTTTGTTTCTGCTTTATCGTTCTGGTGTGAGGACGATTTTGCGAT
TATACCTGCTTTGCAAACATCACCATAATATATTTTCGCTGTATTTATTTAAAATTGGGG
AAATCCATGGTGATGATGATAAAACTCAGGCTTGTTTCTCAAAACATTCGCTGTTGCCGA
GTAAAAGTGTGTCTCTGATGGCAGGTTTGATGTGCATAAAAATTTCATTTACATTGCGAC
TTATTATTGTCTTAGTTTTGCTCGAGTTCTTGGTTCACATAGTGACTGGTGGTTATGAAA
ATTTATTCTGTCATGTGTGCTCTGAATTTCATATTAGAAGCTGTGGTTACCCTTGAGAGC
TGCCTATGTATACATTTTCTCCAAGGTTCCTTTGCTTGGAGAATCATTACGTTTGTTTGA
TCATGCTGTTTAGTTCTTGATTATGCATGCTGTGTTGTTAGCTCAGTTTCATAAATGCAA
ATTCTTGGTTAATTCAATCACCCAATGGGTTTCTACATTAGTGGGCACTGCCTGTCTGTA
GTTAAATTTCCATGTCTATCTGATGTATGATCAGCCTTCTGTGAGGTGAGTAATCTCATC
TGGTATAGTTAGCTGTATTTGTTTCTCCCTTATTTGTTTTGACAGGGAGTATCTGTTTTG
CAGTCCATGTCTTTGACCATGATGCCCATCTGTAGCTTTTACTTTGTTGTTCCCTATGGT
TTAGAAAGAGGTAAAAGCATGAGAGGTCCTAGAACTTGTCCAATATGTGATATTTTAGTC
CTACAACTTTCAAAAGTGAACTATTTAGTCCTAGAAGTTGCACTGCATGTGCAAGTTTAG
ACCAAAGCCAATCACGGATGGCCAAGTGGCGCCAGCTAGACCAAGCCAGTCAGCTGTTGA
ACTTTTGCAGATACCCCATGCCGTTTTGTGAAATCAACCCGCAGTACACCTCACCGGAAT
TAGTTTTGTCTATTGTTCTGTTGGAATCCAGGATGATGATGATGCTCAGCTACTACAGCA
AGCACTCGCTATGTCAATGCATGAGGGAGCTTCAGGAGCTGCAGCTGTGGTTGATGCTGC
TATGGCAGAAGCTGCTGCAGATGACCAGGATTTGGCATTGGGTAGGTCCTTCTATTTCTT
ATGCCAATTTTGATTATTAAACTGGAAGTTTATTTCAGATTTAGGAGAAGACAAATTACC
AATCTCTAGTTTAGAGACATCAGCTTGTCCCATATTTACCCTTGTGTAGGAAAACATTTG
CTTATAATGCAATTTCTCTGAAACTCATAGACCCCAACCTCTGCCTAGCTATTTATTTGT
TTGATGATCGCCAACCGAACTGTACCTAAAAGTTTAGGTGTGTATTGCACCTGTGCTAAA
AGAACAGAAAAAAATTCTTTTGTGAAAAAACCTTGAGGATTAGCATTAACTAACAACCTT
AACCGTGTAGGCGCACATGTAAAATATCAGCAAATATTCAAAAGATAAAATTTCAGAGAT
TCTCGCTGGTGTCATATATCATAATACCATCTTTAAAATGTCCAAATATTTCACGTTGAA
TTTCCCCTGTCTCTTATGTGCATATGTATAGTTATGTCTTTTTCTTAGTAATTGTTATAT
GATGCAGACTTGCAGAACTTTTGTCTTAGCCTCAAATTGAAATATTTACATGTCCTGATG
TGTATTTTTCTATGCTATATGCAGCTCTTCAAATGTCTGTCCAGGACACACAGGGGTCAA
TCTGATATGAGCAAAGTGTTTGAAGACAGATCATTTGTGACATCCATCCTTAATACGGCA
AGCCCTCTCATAGAAGTTAGGACTTGTCATGTAAACATGAATTTAGCAGCAGTTAGTTAT
GATTGGTTCCCCATTGCCTCTTATTTCAGCTTCCCGGTGTTGACCCCAATGACCCATCTG
TGAAAGATCTACTGGCATACTTTGCGTGGCCAAGGAGAGGTAAGAAACCTCTTTCCTACC
TTTATGAGTTCCTTTTGTTCTAGTCCAGTGATGCCATGATGTAACACAGTAACAGTGCTG
TTGTCCTTTTTAACATCACTTTTTACCTTTTATAAGGTGGTAAGGTTCTACACTTATTAT
GGCATCACAGTTTTCAGTGCTAGAGTTGTACCCTCGTGATTCGGTTCATGCCATCTTTCA
TTTTGTATGCTGAAAGGATCTAGTACTTATGGGGACTGACAAATAAAACTACCTCCAAAA
TTCAATAAATAAGTAACGAGTATATATTTGTATCAATTTCATCTTCAGATAAGGGAGAAT
GCTGAACTTGTTAAAGAGTACAGCCACATAGTCATGTCCATAAAAATGGTCTGGAGTGCA
ATCTCACCGCAATATTTATTAAAGAACAATTGGCACCACTTGGTTGTCTGTGATTGGCTC
TGGGCTAAACTTGCACATGCAGTGCAAGTATTAGGACTAAACAGTGCACTTTTACAATTT
TTACGACTAAACCATCACATCCATGCCCTTGTAGTGTACTCCCCCAGTTCCTAAATATAA
GTTTTTTTAAAGATTTCAATGTAGACTACATAAGGAGCAAAATGAGTGAATCTACACTCT
AAAATACGTCTATATACATCCGTATCTAGTCCTTATTGAAATCTCTAGAAAGACATATAT
ATTTACTTAGGAACGTAGGGAGTAGGTGTAGCAAATCCATGTCTCAGCAAATTATGTCTA
GGTACAGCTTGCTTAAAAGAAACATGCAAAACCCTGTGAACTGTGTTTTTGACTGTTTTT
AACAACAGTGAGGAAATGGTGCCTCCACCTCTGTCTACATCTCCAAATCCCGCTGTGCTC
AAGTCTAGGAGAGAGGCTGATGAGCCCTATCTCTGTCCCGTTGATGTGTGAGGCGCCTTC
CGTCCTACAGGCATGATGATGTTCTTCATATGTTCTGTCTAGTTGGTTTTGCGTGGCTGG
TCAAGTATGCAGACCTTGTTTTGATCGTTGTAACATTTGTTCAACTAGTATGACATGCAC
TTCTGCTCTGTAGTGGCATTGAGTGAGGTTTTAGAGGGTTTCTTTTCTCTTTTCTACTGA
ATTATGTATCGAACCTCATGTTTTTTATCTAAAAGGTATATTCTCTGCTCCAACCGAGAG
CCCTCCATTACGTGCTGATCTGCAAGCCTCTTGGTGACACCCGAGAGCATACCGCCTCGT
GCCGCTATAAAACTCACTCCCCTCTCGCTCTGTCTGATCACCCACGGTCGCGCAACCATG
GACAAGTGCTTTATCCGCGAGAAGGGTACTCCTATATGGCGACCTATATGTTGGCCCATT
TTTTTTTTGGTTTTCAGATTTACACTTTTTAAAAAGTTATTTGGGATTTCAAACAAGTTA
CAAATTGTGAAAAAATGTTCGTGATTTGAGAAATGTTCGGCAAATGATAAATTATCACGG
ATTCAAAAAAGTTTGTGATTTCAACAAAAATGTTTGTGTTTTCAAAAAACGTTCACAATT
CTAAAGAAATGTTCATGAATTCATAGGAACGAATAATGTTCCTGATTAGAAAAATGTTCG
GGAAATGATAAATAGTCAATCACTCAAAAAATATTCGTGATTTCAAAATAAAAATGTTCA
TGTATTCATAATTTTTTTTACGTTCATTGATTTTTAGAAAATGTTCACAATATTCCCAAA
TTATTCGTGATACCAAGAAAGTTCAGGAAATGATAAATTCTCATGGATTAATAAAATGAT
TATGATTTAAAAAAATGTTCACAATTTTCTAAATTAAATCCAGTTTTTTTATAAATGTGC
AAAATATTCAAAAATAGTTGGAATTTCAAAATAAAATTCCAATTTTAAAAACATGCCCAG
AAAATTCATATAATGCTAGTCTATTCATTTCATGAGTTTCAAAAAAGGTACACAATTTCA
AAAAATGTTAGTGAATTCTAAAAATGCCATGATTTCAAAACAATATTTATGAATTTTATT
AAAAGTTAAACAATATTTTTGAAGGAGTTCAAATTAGATCAGCAAAGAAGAAGTTCTTGG
CTGTGTTTTAAGGTGTGAATTTGAGTAAGACTCAAAGCCGACCACGACAGAAGAAAGAGA
AAGGATGAAGGTCGTCCCCTATGCCTTAGCCGTAGGCTCTAAAGTATGACATGCTGTGTA
GTGCACCTAATGTGTGCCTTGCCATGAGTCTGTCAAGGAGTACAAAGAGTGATCCAGGAT
TGAATCACTGAACAGCAGTCAAAGTTATCTTTAGTAACTAGTGGACTAAGGAATTTTTCT
CGGTTATGAAGGTGATTCAAGAGTTCTTCGTAAAGGGATGCAAGATTTGACACTAATTCG
AATAACTCTGAGTAGTAAACGGATTCGTATAGTGAAGCAGTCATTTAAAATAATTCCAAA
TGGCGCGTAGTAGCAACATCTATAGGATGATATAGAGATTTGTAAAGCACACACGGATCT
GAAAGGTTCAGATCCGTTGGCTAAAAACTCTGAGTAGAAAAAAATAGAAAAACTGGAAGG
CGTATGATGTTGGTGTCCGTTGCAACGCAATGAAAAAAAACACAAATTTAAGACAAAAAA
TTGAAGACGTAAAAAAAGCACAAATTTAAGACAAAAAATTTAGGACAGACGACGTATGAT
GTTGGTGCCCGTTGCAACCCAATGAAAAAAACACAAATTTAAGAAAAAAAAAAGACGTAT
GATGTTGGTGACCGTTGCAACGCAATGAAAAAAAACCATAAATTTAAGAACCTTTTTAGA
AAGGGAAGGCATATGATGTTTGTGTCCATTGCAACACAATGAAAAAAGAAAACACAAATT
TAAGAATTGTTTTTGAAAACGGAAGGCGTATGATGTTGGTGCCCATTGCAACAAAATAAA
AAGAAAACACAAATTTAAGACTTTCTGTGTGATGTTGGTGCCCTTGCAACGCAATGAAAA
AGAAAACAATTTTTTTTAAGGAAGGCGTATGATGTTGGTGCCCGTTGCAACGCAATGAAA
AAAACACAAAATTAAGACAAAAAATTGAAGACGTAAAAAAACATAAATTTAAGGCAAAAA
AATTAGGGCACTGCTACGCGTCCGCGACAGATGTCTAGTAAACATCCATCACCTCGATAG
CCGTCAGATCTCTGTATGTCCAGCCGTCCGATCTAACTGCTAGCACCCGGCTCTGTTGCC
TCCCCGACGAACTAATTCATGAAACAACAAATTAGTTGCAGAAACAACCGTCGATCAATC
TTTTGGTACGCCCTGCGTATCCCCCCACTCATTAGTTTCTGAAACAATGGTCTTGTTACA
GAAACAGTGTCCGTGTTGCAGAAAGAGAGTGGCCACCGCGACGCCGGCCTCTGCGGCGCT
CGGCGTCGTCGGTCACTTCTTGAAGCTGCGCCTGCACTTCTGCAAAGAAATGTGCATGTG
CTTCCCTAACCCGGTCGTTCTCATCTCGCAGGCCACGGCCAGCCTTTTGGTCGCGATCTC
GACAACGCCCATGTGCACGTGAACGGGAACCTCCACGGTGAGCTCCAGCGCCAGAGCCCC
CTCCTTGGACTCCCTGAGCGCCTTCTCCACCGCCTTGGGCGGCGCATGGCCGCCGCCACG
TAGCAACAGGTTGAAGTCCTTGGCGTCCTTGCTGCCGTCCTTGGGCCTCCCCACTTTCGT
GGCCTTCGCCAGGGTCATGCCCTGGTGCAGCAGCCTGGCCGTGCTGCCGTTCCTGTACCA
CAGCGTCGTCACCTTGTTGGGGTTGACCGCCGTGAGGGAGAAGTCATAGTCCACCTCCAG
GTGGTGTTGCGCCGACGCGATGTGCGAGGAGAGCCTGTCCACGGAGAAGCTCGGTGGGTC
CAGCCGCAGCACGACGACGGAGAGCCAGATGCCGGTGCCCAGGAGCAGCGCGGACACGGC
TGTTGGGCCGAGCATCAGCAGAAACAATATCTCCAATTCCTGAAACAACGACCGCGTTGC
AGAAACTGAAGAGGAATGAATGGCTGCAAAGTTAGAGGAAGGGGAGAGGAAGAGCTATCT
AAAGAGGGATAGATGGCTGCGAGGTTAGAGAAGGAGAGGAAGGAGAGGGGAGAGGGGGAG
ATGCGGAAGAAGAGAAGGGGGGCATGGCTTCTCACCGGCGGGTGGCGTCGCGAATGATCG
CTTGGCGCTAAGGACACGTGGCCATCGTAGAAGGAGGCAGACGCAGCAGACTGATCCATC
GGTTGAAACAAGCTTTTTCCAAAATTTTAGGACGGAAACCGTATGATGTTGGTGTCCGTG
CCAACGCAATGAAAAAANTACAATTGTGGCACGCGGGCCACTATCTCTAAGATCCTACAA
AGTAGGAATGACTACGTTACATAATACAGGAGTGGAATATGTACACGCTAACATGATTAA
TCTTATGAGAAGCTTATGCAACGTCTGGGGATGAATAAGAAAAGGAAAAAAATGTTGTCT
TCTAAAAGGAAACATTTTTTTATTTTCTATTTTAATTTTGTTCTTGTAATGCCAGATGAT
GATTACAAGTGCATAGTTCAGATGATCAAACCATGATTACTTGAACAAATAGTCTTTTGC
TCCTATAGCTGACGGCAATTACAACAACTTTTGATCCAACTATTCGTATGTAGTCTCATG
TTCATTTTTGTTCGACCATTACACTTATTATTCTAATATTCCTAGTCACATTCTTATTCC
TGGGGATGGCATATGTCCGCTCTGTGGGACGGAGGAAGACTCGAATCACATCTTTTTCTC
TTGCGTATCCATGAAATTCCTCTAGAGTTGTTTTCGCAAAGTGGTCGGCGGATATTGGTC
TGACAACAATTTCCCCGACCTCTTCGCCGAACTCTAGGCTTTGCCTCCAAATCTCCGCCG
CACTCGGTGACTGACTATTGGGGTGCTTGTCTGTATACTATGGACGGTTTGGAATAAGCT
TGTGATTCAAAGTTTACCTCCGCGACATGCTACTGACGCGGTCTTCTAAATGTGTGGCTT
TATGCAGCTTTGGCGGCCGCTTAGCCATCCGCGAGACCATGATGCCGTCAACAACATCAT
TGCCCATCTTCGGGCGTTGGCTCCCCGCTTGGCGCCGCCGCCCCCGCCTCCACCACCTAT
GTAAAAAGTTTATGCAGCTTGTTCGGCGCCGCTATATTTTTCTGTTTCTTTGGGCTTGTT
AAGTTGTGCCCTCAGCAGAACCTGCATACCTTGTGTTTGTGCTACTTGCGTGCGCCGTGC
GTGTGTGTGTATGTGTGTTTGTCTTGTGGTTATTGTTGGACATTATGCTTTGGTGGTTTG
TTTCTTTACCTACTAATAAAGCAAATAGTGCTTCTTCCGTACGTCATCCAAATTGCCCGA
AAGTAGTTCTTAACTTATGATGCGTACCTGGGATCATGTTTATTTACTACCAAGATGAAT
TCCACCAAAGATTGCATGTTGTTGTTATCCTTCTCTTTCATTAATCGTATCATGGGCTGT
TTGCGAGTACAATCAAAAGTGCTCATTGGCTTGCCACTGGTTATTTCATTGACGTATGAG
AGAACAGGAATTGGTGAAGAGTAACTCGGACGTTCTTGCGAGTTAGGACGCTTCCCAGTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved