Hordeum_vulgare Locus poly:6:snosnR60_Z15
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:6:snosnR60_Z15
Hordeum_vulgare
poly:6:snosnR60_Z15
chr7H
SNORD14, snoZ43, snosnR60_Z15
1001..1125, 1636..1732, 1983..2077
3076
AGGGCCGCCTCCCTGCTCTGCTCCTCTGCTCCCCGGCAGCGCAAGAAGGACCGGGGCCG
CCTCCTCTCCGGCTCGCCGTTGTAGCTCATGCTTTGCTTTGGAGCGCCGATGTAGCTCAT
GCTTTGCTTTTGAGCGCTGGAGCTCGCGCCAGGCTGCCATCGCGCCGCGAGCCCGACGGC
TCCCAGGTGTACCCCGTCGGCTGCACCGCCGCGTGTCCGTAAAACCATGCCGGAGCGCCA
GCGCCGCGCCCACCGGAAGCAGGAGGCCCCAGGAGAGCGCGTTCAGGGAGTCGTGCGCCC
ACTGCAGCATGGCAGACGCGATGGGGGAGGACTCCGTCGTCGTGGTGAGGATGTCGACGG
TGGCGTGAGACGCCAGGTCGGACGCTCCTTCCGCCTCGACCACACCCGCCGTCGCCCAGC
TCGCGCCGACCAAGAAGCGGAAGAAATCGATCCCCCGGGCCGCCTGCTCTGCTCCTCTGC
TCCCCGGCAGCGCAAGAAGGACCGGGCCGCCCCCTCTCCGGCAGGTGTCCGCCGCATCTT
CCGCCTCGTCTCTGGTGCCGCAGGGGCCTGAGGCATCTTCCGCCTCGTCTCCGGTGCGCC
TTCTCTCCGGCAGGTGCTCGCCACGTCTCCACGCCCTCCATTCTCGGCACCTCCTCTGCT
CCTCCACCCTCTTCGCCTTCTCTCCGGCCAAGCGGGTGCTCTTTCTGGAGGTGGTTGACT
CCCCGCCGAGGGAGGGCAAGAGCTTCTCCTGCCAGCCAGTGTACAAGTCTATGGAGGTTC
TCAGGTCTGGGAGGCGTGTCTCCATCGATTGCACCGACATGTTTGTCCTGGACAGCGAGA
GGAGCAAGAGGCAGCAGACAGCTGCACAGTTTTGAGCAAACTCTGTCACCGCACAAAATA
CTTGGATAAACACTGAACCTGTGGATGTAATTCAGCCAGTACACAGTTGCTTTTTGCGAT
TACAAATTCCTTTGCATGCTTAACCATAATGTAGGAGTTGCTGTTGGTGATGATATAAAA
CTTAGGCTTGTTTCTCAAAACGTCTGCAGTTGCCGCCTAAATTGCTTTCGTCCTTCCAGG
CTTGAGGTCTAATGCTGCTAATTCCTTTCTTGGATGTCTGAGGCATGTTGATTTTACTCA
TTTGAATCTTTCTTTGTCTCTGCTTTATCGTTATGGTGTGAGGATATTTCTGTGATATAC
TTGCTTTGCGAGCATATTTAATCCGGACCTATAATTTCTGATCGTTGGAATTTTTTAAAC
TGAACTATTCCCAAAATGATTGACAAAATTGGACACCATTTGGNNNNNNNNNNAAGATAA
CTATTTGAAATAATTCACTTTTGGAGTTCATAACCATCAGAACTAACTCATTAGATGTAC
AAAGTACTAATGAAAGGTTTCTTACACCACAAATGAAATATTTTAACCCTCATGTGTGTT
AAGATGAATGTGGTTCGTCCATTATTATCTTGATTCAAGAGGACCANNNNNNNNNNAAGA
TAACTATTTGAAATAATTCACTTTTGGAGTTCATAACCATCAGATTTGGAACTAACTCAT
TAGGTTTCTTACACCACAAATGAAATATTTTAACCCTCTTGGNNNNNNNNNNGAAGGTGG
GTTTGATTTTTTGAGAGGACAGTGAAGATTGATATTTGGCGAGGTTTGTAGTAGCTGGCA
TTTGTTTGCCTTGCGGACCATACTACTATATCATCATCTATACTCCCAGTCCTCTATTTT
TTTTTATGTTTGGTGGCAGATGTCTCATTTGTTTTATGTGTAAAACCAATATGGTCGGCG
ATCCATATTATTATGTTACAAAATTGTTGCTTCTTACCTATGAGTTGTGAACTTTATTGC
CAACCGTGTTTGATCAATCTTATGAGAAGCTTATGCAACGTTTGGGGATGAATAAGAACA
GGAAAAAAATGTTGTCTTCTAAAAGGAAACATTTTTTTATTTGCTATTTTAATTTTGTTC
TTGTAATGCCAGATGATGATTACAAGTGCATAGTTCAGATGATCAAACTATGATTACTTG
AACAAATAGTCTTTCGCTCCTATAGCTGATGACAATTACAACATCTTTTGATCCAACTAT
TCGTATGTAGTCTCGTGTTCATTTTTGTTCGACCATTACACTTATGATTCTAATATTCCT
AGTCACATTTTTATTCCCGGGGATGGCCTATGTCCGCTCCGTGGGAGGGAGGAAGACTCG
AATCACATCTTCTTCTCTTGTGTATCCGCGAAGTGGTCGGCGGATCTTGGGCTCACAACA
ATTTCCCTGACCTCTTCGCCGAACTCCAGGCTTTGCCTCCGAATCTCCGCCCCAGTAGGT
GACTGACTATTGGGTTGCTTGTCTGTATACAATGGACGGTATGGANNNNNNNNNNAAAAT
CTACTATCATCTAAATTGGTTGTACGCAATTGAGAGGAGCAACCGAAACAAAATTAAAAA
TCAACATTAATAAAATCATTAGCTTGTGATTCAACGTTTACCTCTGCGACATGCTATTGA
CGCGGTCTTCAAAATGTGTGGCTTTATGCAGCTTTGGCGTCCGCTTAGCCGTCCGCGAGA
CCATGACGTCGTCAACAACATCATTGCCAATCTTCGGGCGTTGGCTCTCTGCTTGGCGTC
GCCGCCCCCTCCTCCACCACCTATGTACAAAGTTCGTGCAGCTGNNNNNNNNNNCCATGA
CGTCGTCAACAACATCATTGCCAATCTTCGGGCGTTGGCTCTGTGCTTGGCGCCGCCACC
CCCTCCTCCACGACCTATGTACAAAGTTCGTGCAGCTTGTTCGGCACCGCTGTATTTTTC
TGTTTCTTTGGGCTTGTTAAGTTGTGTCCTCAGCGGAACCTGCGTACCTTGTGTTTGTGC
TACTTGCGTGCGCCGTGTGTGTGTGTTTGTCTTGTGGTTATTGTTGGACATTGTGCTTTG
GTGGTTTGTTTATTTATAAAGCGAGGTGAAAACCTTCTTCGATAAACAACAATGTATAAA
TATTAACACTGTCACTACATCCTATCTTACTCACACTCTTATGTTCTTTCTAATTGTGCC
ATATATATGGCTGAAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved