Hordeum_vulgare Locus poly:6:SNOR75
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:6:SNOR75
Hordeum_vulgare
poly:6:SNOR75
chr3H
snoZ155, SNOR75, snoZ103, SNOR75, SNOR75
1001..1080, 2228..2315, 2870..2959, 3463..3551, 3630..3714
2084
TAGCAAAATAACATTAATTTTCTTGTTTTCCTCTCCATCTTGGTCATGGTGCACAACCT
AAGATGACCTATACACCGTGACGGAGGGAGTAAGTATAGTTGTCATATGGATGCAGTATA
GTTGTCTTGTCTAGAATTATTAGAAACTCCTACACCACTTTTTGTTTGCTGTGGGAAGTG
ATGTTATCATATCCATACCACGTTTCTGCATGATGATCTATTGTTTTCTTCCTTTGATTA
TATGGACATGAGTGTACTTTCCTCAAATTATCAACTATGACTATATTTTGTGCAAATGTA
TCAGTCTTCCAAGCCATAAATCTGATCCAACTTTTATGTTTTACTATTGTCTTCTGGTTA
ATATTTTGAGTGCCCGTCAGGTTTCCTTAGTTGAAACCAGAAATCAACTCAGCGTAAAGC
TCTATCTAAATCAGTAATGCTCTTTGGTAGTCCTTTTTTCATGTTTTCGTTTGATTCGTT
CTAAAACTTCTGAAGCTAATAATTACAGTCCCTGTTGCACTTATTAATAGCGTAATTTAG
TGGTGCATGTTTGCGGAAGAATATTTTGGGCTAATACTCTGTAACAAGCCATTCTTCAAG
ATTGCTTTTGCATTCAACTTGTCCCTACATATCCTAGCATTGATCTGAATTTTGTTTTGA
TATGGGAATTAGTTATGCCATGAGGTATCTGATGCTTGGTCTTTTTTAATGGCCTTGTTT
CTCGTTAGATTGGCATACAGGGAGAAGGAAACGGGTTTTTGCGACAACTGCTCTCATTCC
AGGAGCTTTCTGTTACTATACCCCCGTTTACATCAGTCAGTTTGGTTATTTTGTTCTCAG
TGATGATTAACACTGATTAGATGTCCGATTCAATCCATTCTATTAAATCATGGGGACAAA
ATGAGGCATTTGTCTGAGAGAACATCTTACCACCACTTTTGCTGTTGAAAACACAATTTT
TATCTTCACATTTCTTCTTTTCTTAATTGTATTTTTTTAGTTCTCTCTGATGGAGAACAG
ATGACGAGTCTGATGTAAGCCATTTTATTAAACCATGTGGACAATTGAGGCATTTTCTGA
GAGAGCATATCCTTCCACTTTTCCCTACGAACCTCTTTAACAGACAAAATAAAGAGTTCA
CACTCCACACTTGTACATCAGTTTTGCACAGGTCTAACAGGAGCTTGTGCATGATTCTGT
TCACACAAAGTAGTAGAGCAAATAAAATGGATACAGCATGAGAAAATAGCCTAGGCCGAG
GAGGAAATCAGTATTCCAAATAAAATGGATCCCGTATATTACAAAGCATATATTACAAAA
AATATATTATTAAAGTAAACTAGTCTGAGGAGGAAATCAGCATTGATCCGTTGATAGCCA
TTTCCTCCAAGGACTTCCCTTTCCCTGCACCAAATCCGCTACTCTGTAAGGCTGCACGCA
ATGGTAGTATTATAGGTAGGACTACCTCCGTCATTATTTATAGGGCATGGCATGCCCGCG
TGTACTTAGGTCGTCAATTTAACTTATATAAAATATTTTGTTTAATATAAAAAATATATG
CTTAACAATAGTTTTGTCAAATTAATGACCTAGATACACGTTGAGTATCATATTAAATGA
TGTGCTACTATGTGTCTTGCATGATAATGAATAAACTACCTTCTGATACTAATATGTGAT
ACTATGCATTACGGATGTGGTATAAGACACTAGTATCATATGCATGATACTAATATATGA
TAGTATCCATTACAACCAGCCTAAACATGAGAATGATCTGTAGAGGAGCCAAATTCAGGT
GATTGGAGGTTTGCCAGGCAAGAGATCAATCAGGTTAATGGCAATTGAGCATCACATTTC
TTTCATTTGAAAGTGGGTATTCATGAATCAGGAATAAATTTTTGCTGCATGCACGTGCTT
TTTGAAAGATGTGGGGCGGTGGAGGCATGGCGGCGTTGTGTGGTCGTGATGGCCAGCGAG
GCAATGATGTGGGGCTGATTGGTGGGGGCCGGAGAGTTGGTGGGGCAGCGTTGGGTGCGG
CGTGGAAGCGGGGCGTAGACGGGCCTTGGGGCAATGGGGTGGCGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved