Hordeum_vulgare Locus poly:5:snoZ43
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:5:snoZ43
Hordeum_vulgare
poly:5:snoZ43
chr7H
SNORD14, snoZ43
1001..1125, 1488..1584
2583
AGGGCCGCCTCCCTGCTCTGCTCCTCTGCTCCCCGGCAGCGCAAGAAGGACCGGGGCCG
CCTCCTCTCCGGCTCGCCGTTGTAGCTCATGCTTTGCTTTGGAGCGCCGATGTAGCTCAT
GCTTTGCTTTTGAGCGCTGGAGCTCGCGCCAGGCTGCCATCGCGCCGCGAGCCCGACGGC
TCCCAGGTGTACCCCGTCGGCTGCACCGCCGCGTGTCCGTAAAACCATGCCGGAGCGCCA
GCGCCGCGCCCACCGGAAGCAGGAGGCCCCAGGAGAGCGCGTTCAGGGAGTCGTGCGCCC
ACTGCAGCATGGCAGACGCGATGGGGGAGGACTCCGTCGTCGTGGTGAGGATGTCGACGG
TGGCGTGAGACGCCAGGTCGGACGCTCCTTCCGCCTCGACCACACCCGCCGTCGCCCAGC
TCGCGCCGACCAAGAAGCGGAAGAAATCGATCCCCCGGGCCGCCTGCTCTGCTCCTCTGC
TCCCCGGCAGCGCAAGAAGGACCGGGCCGCCCCCTCTCCGGCAGGTGTCCGCCGCATCTT
CCGCCTCGTCTCTGGTGCCGCAGGGGCCTGAGGCATCTTCCGCCTCGTCTCCGGTGCGCC
TTCTCTCCGGCAGGTGCTCGCCACGTCTCCACGCCCTCCATTCTCGGCACCTCCTCTGCT
CCTCCACCCTCTTCGCCTTCTCTCCGGCCAAGCGGGTGCTCTTTCTGGAGGTGGTTGACT
CCCCGCCGAGGGAGGGCAAGAGCTTCTCCTGCCAGCCAGTGTACAAGTCTATGGAGGTTC
TCAGGTCTGGGAGGCGTGTCTCCATCGATTGCACCGACATGTTTGTCCTGGACAGCGAGA
GGAGCAAGAGGCAGCAGACAGCTGCACAGTTTTGAGCAAACTCTGTCACCGCACAAAATA
CTTGGATAAACACTGAACCTGTGGATGTAATTCAGCCAGTACACAGTTGCTTTTTGCGAT
TACAAATTCCTTTGCATGCTTAACCATAATGTAGGAGTTGCTGTTGGTGATGATATAAAA
CTTAGGCTTGTTTCTCAAAACGTCTGCAGTTGCCGCCTAAATTGCTTTCGTCCTTCCAGG
CTTGAGGTCTAATGCTGCTAATTCCTTTCTTGGATGTCTGAGGCATGTTGATTTTACTCA
TTTGAATCTTTCTTTGTCTCTGCTTTATCGTTATGGTGTGAGGATATTTCTGTGATATAC
TTGCTTTGCGAGCATATTTAATCCGGACCTATAATTTCTGATCGTTGGAATTTTTTAAAC
TGAACTATTCCCAAAATGATTGACAAAATTGGACACCATTTGGTTGTAAGATAACTATTT
GAAATAATTCACTTTTGGAGTTCATAACCATCAGATTTGGAACTAACTCATTAGGTTTCT
TACACCACAAATGAAATATTTTAACCCTCTTGGGTGTTAAGATGAATGTGGTTCGTCCAT
TATTATCTTGATTCAAGAGGACCAGAAGGTGGGTTTGATTTTTTGAGAGGACAGTGAAGA
TTGATATTTGGCCAGGTTCGTAGTAACTGGCATTTGTTTGCCTTGCCGACCATACTGCTA
TATCATCACCTATATTCCGAGTCCTTTAAATTAATTTGTTTGATGTTTTGTGGCTGATGT
CTCATTTGTTTTCTGTGTAAAACAAATATGGTCGGCAATCCATAGTTTTATCTTATAAAA
TTGTTGCTTCTTACCTATGAGTTGTGAACTTTATTGTCAACAGTGTTTGATCAATCTTAT
GAGAAGCTTATGCAACGTCTGAGGATGAATAAGAAAAGGAAAAAAAATGTTGTCTTCTAA
AAGGAAACATTTTTTTATTTGCTATTTTAATTTTGTTCTTGTAATGCCAGATGATGATTA
CAAGTGCATAATTCAGATGATCAAACTATGATTACTTGAACCAATAGTCTTTCGCTCCTA
TAGCTGACGACAATTACAACAACTTTTGATCCAACTATTCGTATGTAGTCTCATGTTCAT
TTTTGTTCGACAATTACACTTATGATTCTAATATTCCTAGCCACATTCTTATTCCTGGGG
ATGGCCTATGTCCGCTCCGTGGGAGGGAGGAAGACTCGAATCGCATCTTCTTCTCTTGTG
TATCCGCACAATTCTTCTGGAGTTGTTTCCGCGAAGTGGTCGGCGGATCTTGGTCTCACA
ACAATTTCCCTGACCTCTTTGCCGAACTCCAGGTTTTGCCTCCCAATCTCCGCCCCAGTA
GGTGACTGACTATTGGGTTGCTTGTCTGTATACAATGGACGGTATGGAATTAGCTTGTGA
TTCAACGTTTACCTCTGCGACATGCTATTGACGCGGTCTTCAAAATGTGTGGCTTTATGC
AGCTTTGGCGTCCGCTTAGCCGTCCGCGAGACCATGACGTCGTCAACAACATCATTGCCA
ATCTTCGGGCGTTGGCTCTGTGCTTGGCGCCGCCGCCCCCTCCTCCACCACCTATGTACA
AAGTTCGTGCAGCTTGTTCGGCACCGCTGTATTTTTCTGTTTCTTTGGGCTTGTTAAGTT
GTGTCCTCAGCGGAACCTGCGTACCTTGTGTTTGTGCTACTTGCGTGCGCCGTGTGTGTG
TGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved