Hordeum_vulgare Locus poly:4:SNORD14
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:4:SNORD14
Hordeum_vulgare
poly:4:SNORD14
chr6H
SNORD14, SNORD14, SNORD14
1001..1122, 2686..2807, 8148..8249
2121
GTGTCTCCTTCTGCTGGATCGCGTCCGGATGACGGGCGCCGTCTGCCGGTTTTGTCGCG
GAGCCCGGCGGCTCTGTGGTGTTCAAGCAGGAACCTCATGCTACCGGCAGCATGCGGCGC
TTGCTTGAACATCCCAGAGCCACCGGCGTGCCAAAATTCACGCAGAAGGAGATCGATCTC
TCGAGGAGAGATCCGCCGCCAAGCTGGAGTACGTGAACGTCTTCTTCAAGTGCTTCACTT
TTTTCTTTTCTTGCGGAGAACCCCCAATACCGTGTTTATCCTCAACGGAGGTGAGGCCCG
TTATCTTCAATTCTGCATTGTAGGCTGTTGTATCCTCATTGTGTTTTATGTTTTGCTGCC
GGTGCATATGATAAGTATATGCTGTATGCACATACTAGCTTGTTATTCAGTGTAATACTA
GCTTGTTATTCAGTGTAGGCATGTGCGTTCGGGCAGATGATGGTTTGCTCACAGTGTGCG
TTCTAAAACGAACATTTATAATTTAATGGATTTGTTGGCCTGATAATTGTATTTTTTAAT
CCCGACACGCCATTGTTTTTCAGTAGGGAAGAAAATGTCAAATTATGGATACTATACTTT
GTGGTGGGGTTACCCATTGTATTTCGGGCGGCTAATAATACTCAATTTTGTGTGTGTAAA
AATGTGGTTTTTATGTAAATACATTTTTTAACTGGAATGTCAGGTTTGAAGATTCCACAT
GGTAGTTGGTAGCATTACTCATAAGTCAGAAGAGTGATTCATTTGAATCTGTTGCAGCTA
TGGTAATTATATTTGTATTGCACTAACCAGTTGACTTCTTGCTATCCTTGCTTGGTTGAA
GTATGCCTCTATTGTCTTGGTATACCAGCTCTACCTTTTTGCATAATGTTAATACTTAAG
CATACAGTTCTGTACTCCCTTTGCAGAACACTATTGAGCCGTTTTCTGTGATTACATAAT
ATCGTATTTGCTGTAGTTGATTTTAAAGTGGAGGAAATCAATGGCGATGATGATAATACT
TAGGCTTGTTTCTCAAAACATTCGCAGTTGCCGCCTAAGAGCTTTCGCCCTGCCAGGCTT
GAGAGCTAATGCTGCTAATTCCTTCCTTGGATGTCTGAGCCATGTTGATTTTACTAATTT
GAATCTTTCTTGTTTCTGCTTTATATTCTTTTTTAAGAGGTTATTTTTGTGATTATACTT
GCTTTATGTGCTTTACCATAATATATTTTTGCCTCACATATTTGAATTTGGGGGAGATCA
ATGGCGATGATGATAAAACTTAGGCTTGTTTCTCAAAACATTTGCAGTTGCCGCCTAAGA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCATGTTGATTTACCTGACTTAATGTTCTTTTTTGGTGTCTGCT
TTATGATTCTATTTTTAGTCTGATATATTTTGGTGCTCTTTTGTTGCAACTGGCATTTGT
TTGCCTTGCTGACCATGCTGTTATATCACCACCCGTATTTTCTTTTACTTTACCATAATA
TATTTTTTTGGATGTCTTAACAATGTTGATTTACTTGATTTGATGTTCTTTTTTGGTGTC
TGCTTTATGATCCATTTTTTAGTGTGATATATTTTGGTGCTCTTTTGTTGTGACTGTCAT
TTGTTTGCCTTGCTGACCATACTGCTATATCACCACCAGTATTTGCTTTGCTTACTTCAC
GATAATATTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved