Hordeum_vulgare Locus poly:4:SNOR75
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:4:SNOR75
Hordeum_vulgare
poly:4:SNOR75
chr2H
SNOR75, snoZ103
1001..1090, 1367..1462
2461
TCCCTTCCAAATTTGGCTCCTACCCCTCTCCTCCTGAAATTCCGTGCCACCCAACACCA
ACACCGCTACTTGTCGTTGCCTGAGCTGCCATGCCGCTGCTTGCAACCAATCGGGCGCTG
CCACATGTCCCGTTGTCGCCTCCTCGCTCCCCATCCACCGCAAGCCCGACCGAGCGTGCG
TGTGGTCCTCCTGGGCCAAATCGGACCCTAAGCATCTACCCGCACTCAAGGGACACTTGC
TTCCCTCATCCCTGCCGCAGGATCCATTGTCGGCGCCCCCGTCACGACGTGGATCTTCGT
GATATGAGCAGCGCTGCCGCCTTTGACCTCCAAGCTGCCTCGATCCACCAGGGGATCTAG
GGGGACAAAAGTGCGCCTCGGCCCTTGTCGCCCGCATGGGCTGGCCGAGAAGCTCCTCAC
ATGGGCCGGCTCACCTCATCCCATCTAGGCCCATGCTAGCCAGCTCCGGCCCAAGTGGCA
CTCTGGTGAGCCGCCTTGCTAACCCCCGCCCACGCACGTTATTGCTATATTGTGCCGATG
TTTTGTTTCGGCCGAGTGCAAACATTAGGCCCGAGTAGTTTTTTTAGGTTCTGGGAATTT
ATCTAATTTCCACGGAATTTCCTAATTACAGAAATTGCATCATTTTAAAATGCTAATAAC
TATTTAACGGTGCATCGGGTGAAAATTACTTAAATATGTAAAATGTCCAAAATTTTGAGT
AGTTTCATAATATCCAAATTTGAACCTTGACTAAGATATTTAACTTGTTGTTTTAATTAA
ATTTGTGCAAATGCCACGCTAAAATAGTTTGCCTCATAATTAATTTACCGTAACTCCGAA
TAAAATGATTTACGTATGTATCTTGGATAGAAAAATGTGTAGAATAACATGGTGGCATTT
ATTTTGCTGTTTAACAACTCTAAAATTGTGTATAGGCACAACAATCCCGAATCTTAATTT
GCATATGGGGACTTTCCGAAATTTTCATTCGTTGCTATGGTTCTGTGTGTGATGATGAAA
ACAGATGATGAGTCTGATGTAATCCATTCTATTAAACCATCTTGACAATCGAGGCATTTG
TCCGAGAGAGCATCAATTCGTTTATTTGTTATTTTTCTGTTTTCAAATATAACTATTTTT
GACATTAAGACAGGCAGTTTGTGATCTATTTGATGATAATTTCCTCCTACTTATTCTGAA
TGTCTAGTAAGCAACACATTCTGTCATGGATGCTGTATAGTTGTCTTGTCTTAAATAAAT
AGAAACTCCTACAACATTTTTTGTTTGCTGTGAGAAGTGATGATATCATATCCATACCAT
GTTTCTGCACTTACTGTGATGATCAATTGCTTTTTTCCTTGGATTATATGGACCTGAGGA
TACTTTACCCAAATTATCGACTATGACTATACAATGCGCAAATGTAATCCCATCAGGATT
CTAAGCCAGAAATCTGGTCCATCTTTTATGTTTTACTATTGTCTTCTAGTTAATATTTTG
AGTGCTAGTCAGGTTTCCTTTCTCCAATCAGGCTAAAGAATTACCCTAGTTGACACCAGA
AATCAACTCAGCATCAAGCTCAATAATGCTCTTTGGTAGTCCCTTTTTCAGGTTTTCATT
TGATTCGATCTAAAACTTCTGAAGGTAATAAATTAGAGTCTCTGGTGCACTTATTGATAG
CGTAATTTACTGATGTATGTTGCCGAAAGGATTTTTGGGTTAATATTCTTACACCCTGGT
TTGCACTTGGTTATCACAGTAATGTGGAGTAGCTTGTTTTGTATTATTTTACATGTCTGC
TAATTATTGTGTCATTCACTCCTGCTTGTGTCAGTGCTAAAATTCCTCCAGTAAAGCAAA
AATACCATAAACATATTGAGTTTGCTTGTCTGCATTTCCTTTGTCCAGAATTTCCTGGAA
CAATCTTAGATACTTTGAATTTTAATTTTCAATTTCTGTGACCTATTTAGGTTGGACTAA
TTATACTCCAGAATTTATATCTCAGGATTTTTAACATCATCTTCAGGATGAACACAAAAT
CTTTTTATTTCTAATATTTTTTATATTTGTTATCTTTTGATTGATTCATGTGTCGTGTAA
TATTCTTGTAGGTTGACAAGTTGTGGCATCTCGAGCATGCCTCATAGGAGAGCAGAATGA
AGTCCACTGTACTGTTGGGAATAGTAGCAGATGTGCCATTATTCTATTGTGCAATTTTGT
TCGTTTTTGCTATATTCCTGTGTAAGGAAATGTATTCATGAGATGATTTATTGTGTTATG
TAAACCTGGGATATGTATTTTGTGATGTTATATGATGGATGATTTTAATTCGATTTGGAG
TATTTTTGATTTGAATATGAAAAGGCCCAACAAATAATTTGGTTGAAAAGGCCCAACAAA
TAGAAATGAATCCAAATTCTGGAACAAAAAGTTGCTGAATTCCAAAATGAAAAAGGGCAA
AA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved