Hordeum_vulgare Locus poly:3:snoZ43
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:3:snoZ43
Hordeum_vulgare
poly:3:snoZ43
chr6H
snoR11, snoZ152, SNORD14, snoZ43
1001..1101, 1341..1436, 1920..2041, 2136..2232
3351
TAGGTAGGTATAGATTGTGTCAATCCTTAAAGAAATATTACGCTTATTTGGCTAGCGTA
TAATGTATATATTTCTCACGTTGCAACGCACGGGCATATTTGCTAGTATATATTCAACAA
TAAGGAAGATTTTTTTTTCAATGTCAAATAGGGCAAAAATATTTAAGCCAGTGTTAAATA
GAAAATTCTCTCTTTAATATATGTATGTTATTGTCCATAATTAGCTCAAGCCCATCCCCA
AACTGAACACACACCCTAACCACCCACGGGCCGTATTGAAGTCTAAATCGGCCGACTCTC
CCCGTAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTCCCCGTAACACAACCCCGGCCCAC
GCAGGAAGATCTCTCTTCGTCTCGCACGGCCCCGAAGGGAAACCTAGATCTGTTTCTGCC
CCTATATATGTACTGATCCACCCAGAGCAAACGGCGAAACCCAGCCCTGAAGCCCTAGCC
GCAATCTACCTCTACTTATATCTCAAGCACATCCATATACTTTTGTTCGTCCATCGATGT
ATTTTCTTGGTATCATATCATATGAGGGGGATTGCTTGTGATGATTCAGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTGATGATTCAGGTCCGAGAGGATCTTAGCGGATTTCGGTGAGGCGGATTCGTTCGCCGT
TGATCGTTTCATGTTGTTACACACGCTGAAGCTTTCCTCCCCTTTTAGATTGCCGATACC
TGCCTTTTTCCATGAATTTCTTTTCGCTTATCGCAGTAGATTGGCTTGTGATGATTCAGG
TCCGGAAGGATCTTAGCGGATTTCGGTGAGGCGGATTCGTCCGCCGTTGATCGATTCATG
TTGTTACACACGCTGAAGCCTTTTCCTGCTAGATTTAGCTTTCCTCTGATTTGATTGCCG
ATTCGTTGGCTTTTCTGGTGATATCTTTTCGTTTATCGAGGTTGTTTTGCTCGTGATGGG
TTAAACTCAAAATGACGCTGAGGCGGATTCGTCCGCTGATGATCGAATCATGCTCTTCAA
CAAACTGAGGCCTTATGCTTCCGACGTTTTCGTTTTAGTTTCCATTCGCTTTCTCTGTTC
TTCCATGTTTTCCTGAGATGCAACGCGATGATGATTCATATAGGTTTTCGGCAGTGGTGT
CATCTGTCACCGTGAGCCTTCAAACCAAAAAGCGACTTCTCTTTCCACTGAGTGTTGCCT
TTGATCTGATGTTCTCGCCTCATCTGCTTTCTTCTGTTTCTTGAATTCATCCTGTCTCGG
TGAAGAGCTCTCGGCCATAGGAAGTGCCGTATGACACTGTAAACAGCAGCTGCTTCTCTG
CTGCTGCAAGTAGTCGTCCTCTTATCTTAACCTTTGTGGTTTCGTCTGGGACGGAATACC
CATTTGCACCAGCTTGATTCAGCTGTGTGCGTGATTTTAAACGGGTCTCTGAGGGGCTTA
TGGTGCCTTCTATTCTTCTTCTATACTTAATTGTTATGGTGTTTTTGATTGGGCCCGATG
CCACGTCTCTGATAGCTACAGCCTTGACCGGAGATGCTACATTGTGCCAACAGAGAGTTC
TTGACGTTTCACATTTGATAGGAACCTGTGGCTGTGAATCAGTCGGTACACAGAGCCGAT
TTTTGTGATTATACTTTTTGGTTACGTATACTTTAGGGTATTGAATTTGGGGTAAATTAA
TGGTGATGATGATACAACTTAGGCTTGTTTCTCAAAACATTCGCAGTTGCCGCCTAAGAG
CTTTCGCCCTGCCAGGCTGGAGAGCTAATGCTGCTAATTCCTTCCTTGGATGTCTGAGCC
GTGTTGATTTTCTCAATTTAATCATTTTTATGTCTTTTATGATTCTTGTTTTAGTCTGTT
TCAAGAGGATAAGTAGTTTGGTTTGAATTTTGGAGAGGACGGTGAAGATTGATATATGGT
CTCGTTCGTCGTAACTGGCAATTGTTTGCCTTGCCGACCATACTGCTATATCACCACCCA
TATTCTGAGTCCTTCAAATACATGTTTCATTTTTTTTGTTCTTATTGATATTCATTTTTT
TGGTGTTTTTTGGCTGATGCCTCATTTGTTTTATAAGTAAAACCAACTTTGTTCTTTTAA
TTTTATTGCTGTCTTACACCTATGATGAGTTGCGAACTGTATTGCCTACATTGTTTGATC
AAAATCTTGTGAGAAGTAATGCAACGTCTGAGGATGAATAAGAAGTGTTGTCTTCTGTAA
AAATTGCTATGCTAGTTTTATTTGGCTGATTTCTTCCTTTGTTTTCTGCACAAAACAAAT
TATGCTGTTTAAATTCTTTATCTTCATACAAAGATGAGTTGTGAACTAATTTGCCTAAAT
TGTTTGAACAAATTCTTATGTATTTGCCTTGTTATGCTGGGTGTTGATTGCAAGTGCATA
ACATGATCCAACTGTAATTACTAATGATTAGTCTTTTGCTCCTAGGTGATGGCAATGCTG
CTATCTGTAATATGTTTATTATGATTGTAATTGAATTAGTTGCTACAAAAATGTCTATTC
AATTGTTAAAGATGCCTGCCAAATTTGAGCAACTTATCTTTTAAGAGCTAGGATTGTTGT
AATAACCTGTATGGATCTTGTTTGTTTCATAATGCTAGATCATCAATACGCTGTTGTTAG
AATCAAAAATTGTTTGGTAAGGTGTTGCTAGTCAAAATTTACCAGTACAAAAGGAGGTGG
CTAATGCTATTTGCCCTCATTGGCCCTGTTTGGATGTTTTGTGAGAACGATGCTCTTCTC
CGCATCGACCTTTTGGCGTAGTCGGCCCTCTTGGAGGAGGAGGGTCCCATTGGTCTGGCG
TGCTTCGGCCTCCGTATCTGAGGGGAGTCGTTTCCTTCTGACTTCACCCTTCCACGCAAC
AGTTCAAAGTACAACAACACCGCCAAATTGGAGGATTGGTTGATCGACTACACCATAATT
TTTGACATTGCTTGGGGCAACAAGGGTGTAGCCGTTTGCTACGTGCCACTCATGTTGACT
GGCTCTGTAAGGACTACCAGTTTCCAGCTGACAATGTCAATTTTTGGGTTGACTTTGAGG
AGGCGTTCGTTCGCAACTTCATTGCCACCTACAAGCGTCTTGACTGGCATCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved