Hordeum_vulgare Locus poly:3:snoZ221_snoR21b
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:3:snoZ221_snoR21b
Hordeum_vulgare
poly:3:snoZ221_snoR21b
chr5H
snoZ221_snoR21b, snoZ221_snoR21b, snoZ221_snoR21b
1001..1095, 1456..1549, 1959..2051
3050
CTCCTGCACCTGTGTGCGAGCTATTGTGTGTCTTTTAAATACTCTATTTCGATTCTATT
ATTGTGCTCTTATCCTATTTGTGGTTTTCAGTCTGTGTTGAATGCTAGTAATAGATAGGC
ATTACCTGCTTTCCCATTTGGAATTTCACTCTGCTATCATGCAGAGGTGGTTACTGCTTT
GTGATGAGCTTGATTCATGCCATAATATTACAGTAGTGATTTTGCTAGGAACATCATTAC
CACTTGTCATTTGATTTTGTGTGTGCGCCTCTCTCACCTTTGTCTTCTTGGGGTTGACCT
TTCTGCAAGTGGCCCAGTCATGGAGGCAGGGTGTTTAGTTTGTTTTACCGAAGCAAAATG
TTACTTAGTTCTGACCTTATATTTGTGCTCCGGGAGCCTCTCAGCTTTGTCATCTTGAGA
TTGTCTTCCTCAAAGTCTAGTGCACATAGAGCTAACTGTTTATGCTTTCAAAGTCTATAT
CTGCCTTTTGATTGCTGTGGTTATGTTAAATTTATTTCTGAAGTATTTAAATCTTTCATC
TCACTATTTTTTGGCATCCTGCTTGCTTATTTTGTTTAGCAATAAGGTTGTGCTGCTTAT
TGCCCTGTTATTTTAGTATTTCCTCCGGTTTAAAAGGCCTAGATGCAGATTCTTAGGATA
GTTATTGATTCGATGTAAAATGAGTTAAAAAATTGATTGGATGTAAAATGAGTTAAAAAA
TAGCATTCACACTAGCATTCACACTATGCAATGTGCGTCTATTTTAGAAACGCACGCAAG
TCTAATTGTGCATTCTAAACCGTAACGGAGGGAGTAGTAATGTTGAATTTCGGTGATTTA
TTTATGTGGCAACTGCTTTTTCCGATGATGATTCTGTCTGAAAAATAGATGCTCTGTGGA
CACAAGCCCCTGTTTCAGGGAGAACCTCTTGAGAAAGCAGATGTAAAATGGCATCAAATA
ACAAATCTGAGGTATTCCATATTGTGCTTCCTAATATCAAAAGGCTATGATGAGAAAAGT
CATGCACCACTCTGAAGAAATTTATTTTTTTGTGCTGATAAAGCAAACTTACAACCCATT
TTTACATCTGACCCACCTCATGAAGACCTACTTTTGTATTTTTTGTTTATTGTCTCGCCA
TAGATGTCTAGTGTTTTTTCAGAAACTGTTTACAGATTTAGCCATTGGGAAAATACTTTA
GTTTTGAACATGAGTCTCAAGATTAACTAGATCGGGGGAGTAATGTACAGAGATGACGAG
GGTTGCCCAAGAGCGGTCCTACCATGATGCGGACTGAAATTACATTGAGGTCAAATGATG
GTTATGTCTTCATTCCTCCTAATCTTGAATGCTTTTTTTTTTCCTATTGGTGTCTTCGTG
AACCTGATTGCATTGCATCCGAATTACTTCTTGGTTGATCATTCTGTCTGCAAAATGGAT
GCTCTCTGGAAGCAAAAGGCTATGATGAGAAAAGTCATGAACCACTCTGAAGAGACTCAT
CTCTTTTTGCTGATAAACAAACTTTACAACCCAATGTAAATCAGAGCTACCTCTTGGATA
CATATTTTGTATTTTCTGATTTTTTTATCCGCTATTTTTGACGTAGATGTCTATTGGTTT
TTTAGGAGATGTTTCCAGTCTTTGCCTTCAGGAAAAATACTGTATTTTGAAAATAGAAGT
CTCGAAGGTTAGCTTGATTTTAGGTATAATGTACAGAACCAAATGATGAGGGTTGCCTAT
GTACAAAACAAGGCTCTGATGATGCATTTGCCGCTGCTGCCCTCCTGAATGGATGTCCCC
TTCCTATTTTGAATGGAGTGCTCTCATCTGATACCTGTTTTTTCCCCTCTGCAGCTGAAC
TCAGCATCTGAGTTCCGTGAACCTTGTTGCATTTCATCTGAATTACTTGGTTTTCTGATG
ATGATTCTGTCTGCAAAATGGATGCTCTGTGGAAGCAAAAGGCTATGACGAGAAAAGGCA
TGCACCACTCTTAAGAGATTTATCTCTTGGTGCTGATAAAGAAACCTACAACCCATTTTA
CATCTGAGCCGCCTCAAGGATAAATACTCGTATTTTCGAATTTGTTTATCTGCATTTTTT
GCCATAGACATCAAATGTTTTTTGAGAAAATGTTTCCAGCTTTTGCCCTTGGAAAATACC
GCCTTGTTGAAACCCGGATTGGAGGAATAACGTACAGAACCGGATGTAAAATGGGTTGCC
TGTGAGCGATCCTGCCATGATGCGAACTGAATTACATTGAGGTCAAAACATTTGCTGCTG
ATGGTTCTTCCCTATCCTTCCTGTCTTTAACAGATTCCGCCCTAGTTGGGGATGTGATGC
AAAACAAATGGAGTGCCCTGTTCTATTTGTTGATACCTTTTCTTCCGCATCTTTCATGAG
CTGTGTTGCATCATATCTGAATTACTTACGGTTTTGCCAATGATGTTTCTGTCTGCAAAA
TGGATGCTTGAGCCCCTGTTAAAGGGAGAACCTATGACAACAATCGACAAACCTGAGGCA
TTGTGTAAAACAAAAGTCATTTACTGGTGCTTGCATTTTTGTTGCTTAATGTTGTATATA
TTGCTTGATGAAATAATTCATCTGTTCAGTTTGTTATATATTGCTTGATGAAGTGTTTCA
TATCTCCAGCCTGTTGTTTTTGCAATTTTACAGTATCACTTTGCCAAGACGTGGTTTCCC
AAACTATTGTCTTTTCCTGATAGCAGAAAGCCATTTCATGCACAAGGAGCTGCTTAACCT
ACTGGATAATATGAAGCACGTGGTGTTCTCCTTCTAGATGGTGTTCTCCTTGTGGATCAT
GATTGTAGCCTTGTACCAATGATAGAGGGAACATTGTACCGTGATTATATCTGGTTTTGT
AGGCTTGCCTTGCCTGGTCAGATCCCACAACCTTGGCCTTGGCCAGAGCCCTTGTGATTC
TTGTGAGAAATTATAACATGGTCGTATCATTGTACTGTGATTGTATATCAATTCTTTTGC
GGGTCGTTTATGAGCATCATGAATGCACGGTCAATTTTAGACATGATGCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved