Hordeum_vulgare Locus poly:3:snoZ103
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:3:snoZ103
Hordeum_vulgare
poly:3:snoZ103
chr7H
snoZ103, snoZ103, snoZ103, snoU36a, snoZ223, snoZ278, snoR83, snoR8a, snoR77Y, snoU36a
1001..1100, 1176..1275, 1417..1516, 2290..2375, 2423..2519, 2636..2751, 3556..3681, 4002..4087, 4214..4295, 4499..4586
2099
CTCAGGCGTTGTCGCCCACCGGATGCCCCGACACGGGTAGCCTTCCGACGGCGGAGAGT
CGCACGGTCGCCTAACCTGTGGTAGCTGCCGCGGCGTATCCGCTTTCTCAGTCCAACCGA
GGTCGGCGGTCCGGGCGGCGAGTTCCCACCGATCTGGGATTCGAAGCTCGTCTCAGCGAA
CCCTGGTCGATCTATACTTTTGAATTCATGCCATTGCTGTTGTTTTGCCGTGCATACTCA
CGCCTGCCAGTTTTCGTTACGTCGAGATCGGTTATATATTCGATTGACGGTCCCCGTGAA
GATAAAATTCAGGTCCAAAGACGACTGATGACTGGTTTTAGCCTCAAGCCGTCTTATCTT
GCAGTTTTGTTGAGCTGGTGGCTTGGCGCTAAAACCATTGTTAGGGTCGTCGGTGATGGC
CATATTAGCTATGAGATCTGAGGGACGCCATCAATATGATCACGTAATCCGTCCTTCTCC
TTTGATTTCTACTACGGTTAGCGTAATCCCTCCTTCTCCTTTGGTTTATACTACGATTAA
CCTAGTGTACCATTGTCCTGTTAAGTAGTTTTATTTGTATGTGGTATCTAGCTCAAGTAG
CGGTATCCCAATGAAGAAAGAATTTAGTCCCAAAGATGAATGGTCGATTAGTTTTAGCTT
CAAGCCATTTAGTGTATTCTTTGTACCCGTGGCTTGTGGCTAAAACTAGTGTGCTTTTAA
GTTTGTCTGTGATGGCACATAGCTATGAGATCCGAGGGATGCGACCATGTGAGCCATTTA
GCTTGTTTCAGCTTTGGTCATCCTTTTTTGCTCTGTTAGGTATTTCTGCTTTGGATGAAT
TTGATCTGCTCCAGTTTGACTTTCTGGTCTAATAGAACAGTTTCTTTTCTTGTTAGCAGA
GCTTACACTCCTTTCTTCTAGTAAAACTTTTGAACCACAAGCAATTAGACCAGTTGCCGC
CCATGGATTCTCTTGTTTCTGAGATTGCGTTCTGGATTTAGATGGAAGTGAGGATCCTTT
CCCCAGCTGATCGACTATGATTATACTGTGCGCAAATGTAATCCTTTATCAGAGGATTCC
AAGCCAGAAATCTGATCCATCTCTTTCAACAATCTCCATCCCCCTTTTCCCGTCTTGTAT
GTTACCTTTGTTTTGCTGCTTTGATTTGTGTATTGAATGGAAGTGAGGATCCTTTCCCCA
ACTGATCGACTATGATTATACTGTGCGCTACTGTAATCTTCTATCAGAGGATTCCAAGCC
AGAACTCTGATCCATCATTGTTATCTTTGACACCTTAGTTTTTTTTAATTTATTTTGTTT
TCACCACTCAGAAATTTAATCCTCTATTGGAGGATTCCAAACCAGACATCATCTCTTCTA
ACTTTCTGATTTTGATTGTTCTATTTTGAGTACTTGAATGGAAGTGAGGATCCTTTCCCC
AAATGATCGACGGTGATTATACTGTGCGCAACTGTACTCCTTTATCAGAGGATTCCAAGC
CAGAAATCTGATCCATGTCTCCAAATAATCTTGACGCACATTTTTCTGTTTGTATTGTTT
GTGCTCTGATTTGTAAATGGAATGGAAATTAGGATCCTTTCCCCTTCCATCAGGATTCCT
AGCCAGAAATCATGTTAGTTCCTTTTTGTGTTTGTTTTAAGCTTATCATGTGATTACTTT
CGTTTTCATATTGTTGTTTTCCGTGATTTGCTCCGAAATCTTTCTCGGTGAAGCGAGTAA
AAGCAGACGGGCGGTCTGAACTGATGCCATGTTGATATGTCTGCATCATCTGTGCTTACC
CTTGTGGATAGCATCTGAGAGAAAACAAGATGTTTCTTTTCCAGCTGTATGTTTCTGTTT
TCTTATTGTAAAATTTGTGTCTAAGCTCATATTCGTCCTCATAGATTGATGTGTTTCAGT
TTATTACTTTGCCCCAATCCGAGGCCATTGCTCGTAGTCAAATGTATTGTCTCAGATTTC
TGTTTCCGACAATCTGAAAATATCCTGCACTCTTAATGCAAAATTCCATGCACGGACTAA
TGAATCTCTGATTATTATCTGATGATGCCTTCCATTCACACTCTGCATTTGTCAGCTATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved