Hordeum_vulgare Locus poly:3:snoZ103
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:3:snoZ103
Hordeum_vulgare
poly:3:snoZ103
chr6H
snoZ159, snoZ103, snoZ103
1001..1095, 3149..3238, 3368..3463
2095
CGTTTGCTGACATCCGATTAAGTTTGGTCAAACAAAATACCGCTAGTTTTGTAGTGTGT
ATTTTCAGTCCTATAATGATGAAATTTGTGGAACGAGCTACGATTCAGGTAGCCCCTTTG
TCTGATTTCGGTGGCAATGGAGGTGTTGCGTTGCTTAGTGGCAAGGGAACAAAAATACTA
TGAATCACAGGAGGCCTTATGAACAGGATATTTGACTGAACATGATCAGAGGTTTGACTG
AAAAAAGAACCTCATGATCTTAAACTCACTCGAAATGAACGTGATCTTTAACTAACTAAA
CAATTGAAAGCAAACACATAATAGTGGCACAGCTATTTATTTGGTTTCATATATTTATAA
TTGTTCCTTACAAACCATGAATAACTAAAATTCTTACCTATCTAACAACTGAATGAGTAA
ATCCTCTGCTCTTCAGATGAGCTGAGGGGGAGGCTGTGCTTCACAACTGGAAGAATGGTC
TGTTGTTAACAGTTTGATCATCCTGTTGAGGGAAGCATAGATGAATGGAAACACGGGCCA
GCATTAAACAGCATGCCGCTTTATCAAACTGCATCTTGTTACCTGTCTTTTGGCACATTT
TGTAGCATTAGACAATGTGACTATTTCTTTTCTTGAGATTTTATTTTTGTTTGTGATTTT
ATTGTTTCATTTGGTGGACGTGACATAATTTTGATTTCTTGATGTTTTGTTCTATAAACA
ATCAATTCTGGTGGTGTTTCATTTCTTTTAGTTTCTGTTCTGTGATTGCGTTCTTGATTT
AGATGGAAGTGAGTATCCTTTCCCCAGTTTATCGACTATGATTATACTGTGCGAAAATAT
CAGAGTATTCTAAGCCAGAAATCTGATCCATCTTGCCCAACAATCCCTGCCCCCCCTGTT
CTCTGTTCGTATTTTACCTTTGTTTTCTCTGTTTATATTTTACCTTTTTTTCTCTTTGTT
GGTATTTTACGTTTATTTTTCTGTTCGTATTTGTAAATTGGATGGAAGTGAGGATCCTTT
CCCCAAATGATCGACCATGATTATACTGTGCACAACTATAATCCCACCGGGATTCCAAGC
CAGAAATCTGATCCATCTTTGTTATCTTTGCCACCCTGTTTTTTGATTTCGTTTTGTTTT
TACTATTGATAAACTGAATGGAAGTGAGGATCGTTTCGTTTTGTTTGTTAGTCCCTCTGG
ATTAGTATATATTAGTCGGCTTGTCACCAGATAATCATCTTAGTCGGTCACGCATTACGC
GATGTTTGCCTCGATAGTTACCCATCCGCCCATAATGTAAGACGTTTTTGCAAGGTAGTT
TTATTCTTATGCATTAAAAGGATCTGCATGCATAATAGGTGTCATATGTTTGTAAATTAA
TTTTAGTTTTTGGGTTCTGTTTTATGATGGGCTGAGGTGATGCTAAAACAAGATATTCCT
GAGATTTTCTTTGAGAAATACAATATCTAATGTTTGTTTTCTTCTATACACTTGCACATG
TTTTAGCCATTACTCTGTACCATATGATTGTAGCTTCTGCTGTGAATAGCTACAATATAC
AATGGGCATCTACAATACTTGTTCCCATAAAAGAATTGTACATGATCCAATACTCAATTA
TCTATTTAGTCTAGTAGTCTTAAAAACATCATATGTTTCACTCAATACTCAATTTTTTGT
TGGCATTCTCACTTGCCAATGGAAAAACCATATGAATCTTTGACCTGTTCGGTTTAACAT
TTTAGTTCATGGTGCATTATGTGTATAGATCCAACGATGGACAACTGTTGCATCATTGGC
ATCGGAAGCTCAAGAACACTCATGATAAACAAGATCATGCCTTTTGTTTATTTATCAAAA
TAAACAATTAACATGATCTCAACTTACTCACAGTGAACACATGATCAGGCCTTTTGATCT
AAGTATACAATTAACATTGATCTTAACTGACTCATGGTCTTTTAACTAACTCACCATGAA
CACAGCCCTTTAACTGACCTAACTCACCAAACAATTAAAGGCAAACAGTTCGGCGCAGTT
TGATTTCCTGTACAAAGATGCTTAAATAACACTGACATTTGTTTTTTAAGAATAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved