Hordeum_vulgare Locus poly:3:SNORD14
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:3:SNORD14
Hordeum_vulgare
poly:3:SNORD14
chr6H
SNORD14, SNORD14, SNORD14
1001..1121, 2112..2232, 2435..2555
3555
AAACAAGCCAGAACAAACTCATGAGAAAGATTTCGTTCGATATTTTCGTGGACAGGATC
GCACGGGCTCGATCCTTACAGTAGCCATCAAGTGCAAGGCAGTGCACCCGACATATGAAG
CGTCCCCGAGTCGTAGCAAGCTACAAGGACTCTTTAAGATACAACGAGAACCACTGTAAG
TCGACCGTCAACAAACGAATCCACTAGATCACGAACCCCAACCTAACATCATGTATTTGT
TGGAAGATTGTCCTATAAGCAACTACTTGAATTCCCACCTAAGAATTCCCAAAATTTCTG
GTCATGCAATCTGATACACGGATACAAGGAGTAATATATCACACAACTCCTATACTAACC
CGTCCAATGTACCACATCTGTCAACACACGACCAGAATCTCGGACCTTCATCTGCTACAG
ACCCTCGTGATCACAACTATGCAAAGTATGGTANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGCTTTCGCCCTGCCAGGCTTGAGAGCTAATGCTGCCAATTCCTTCCT
TGGATGTCTGAGCCATGTTGATTTACCTGACTTAATGTTCTTTTTTGGTGTCTGCTTTAT
GATTCTATTTTTAGTCTGATATATTTTGGTGCTCTTTTGTTGCAACTGGCATTTGTTTGC
CTTGCTGACCATGCTGTTATATCACCACCCGTATTTTCTTTTACTTTACCATAATATATT
TTTTTGGATGTCTTAACAATGTTGATTTACTTGATTTGATGTTCTTTTTTGGTGTCTGCT
TTATGATCCATTTTTTAGTGTGATATATTTTGGTGCTCTTTTGTTGTGACTGTCATTTGT
TTGCCTTGCTGACCATACTGCTATATCACCACCAGTATTTGCTTTGCTTACTTCACGATA
ATATTTTTTTGCCTCACATAGTTGAATTTGGGGGAGATCAATGGCGATGATGATAAAACT
TAGGCTTGTTTCTCAAAACATTCGCAGTTGCCGCCTAAGAGCTTTCGCCCTGCCAGGCTT
GAGAGCTAATGCTGCCAATTTCTTCCTTGGATGTCTGAGCCATGTTGATTTACCTGTTTT
AATGTTCTTTTTTGGTGTCTGCTTTATGATTCTATTTTTAGTCTGACTAGCAAAAAAGCC
CGTGCGTTGCAACGGAAGAGAAAATAACACACGCTTTGAACGTAATATATTAGCACATTT
GTGTTGTCGACGATGGCTTCGGTGCTCACACAATGAAAACGCGTTTGAATGTACAATCAC
TCGGAATAAGATGAGAAATATGTTGTTTCTCCCCACAAGATTTTCCAAATGTGTGCATGT
GTGGTTAATGATGTTTTCTTTCCTCTCAATTTGGTTTTAATTTAATGGATATTTATTGCA
ATTCGTACGGTCGTTGGAAAGAGAGAGAAAAAAGACAGTGCATTACAGATTAAGTTTGCA
CCAAAAATAATATTTAAGAAGTATTCAACAGCTAAAAATAACATCCTATTTAGATTCTAC
ACATTTTTTTAATCAAATTTCATATATAACATGTTAAAATCGGAGTTACGGTTTAAAAGA
TATGGATAATTTTGTTTTAGATAAAATATGGATTGATTAACTGAAAAGTCAGGTTTTTTT
TTTGTTAAAACAAAAAAAAACGTTTCGGCTGACTTAAATAGGGATGGTGGGTTGATTACC
TGAAACATCAGGGCGTTTTCTGTAAAATGCAAAAAATGGTTTGGCTCTGACTAAAAGATG
GACCGCGGGTTGATTATCTAAAACTGTGAGGACTTTTCTGCAAAACAACAGAAAATGGTT
CGTTCTGACTTAAAGTTGGACTGCGGGTTAATTAACTGAAACTGTGAGGGCTTTTCTGCA
AAATGACCGACGACGGGCGACAGAAGCGCTGCGCGCTTTATTATTAGGGGAGATATATTT
TGGTTCTCTTTTGTTGTGACTGTCATTTGTTTGCCTTGCTGACCATACTGCTATATCACC
ACCAGTATTTGCTTTGCTTACTTCACGATAATATTTTTTTTGCCTCACATAGTTGAATTT
GGGGGAGATCAATGGTGATGATGATAAAACTTAGGCTTGTTTCTCAAAACATTCGCAGTT
GCTGCGTAAGAGCTTTCGCCCTGCCAGGCTTGAGAGCTAATGCTGCCAATTCCTTCCTTG
GATGTCTGAGCCATGTTGGTTTACCTGATTTAATGTTCTTTTTTGGTTTCTGCTTTATGA
TTCTTTTTTTAGTCTGATATATTTTGGTGCTCTTTTGTTGTGACTGTCATTTGTTTTCCT
TGCTGACCATACTGCTATATCACCACCAGTATTTGCTTTGCTTACTTCATGATAATATTT
TTTTGCCTCACATAGTTGAATTTGGGGGAGATCAATGGCGATGATGATAAAACTTAGGCT
TGTTTCTCAAAACATTCGCAGTTGCCGCCTAAGAGCTTTCGCCCTGCCAGGCTTGAGAGC
TAATGCTGCCAATTCCTTCCTTGGATGTCTGAGCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTAGGGCGAATTCTTGTTATAAGTAATCATGAGAAGTTGGTATTCAT
TCAACATTTTGATGATGTGTATGTTGTTGCTTCTCTTAGTGGTGTTGTGTGAACGTCGAC
TACACGACACTTCACCATGCTATGGGCCTATGGGAAGACAATGTGGAGTAACAAGTAGAT
GATGGGTTGCGAGAGTGACATAAGCTTAAACCCTAGTTTATGTGTTGATTCATAAGGGGC
TGATTTGGATCCACACGTTTCATGCTATGGTTAGATTTATCTTAATTCATGTTTCATAGT
TGCATGTGCTTGTGAGAGGGGGTAACCATAAGTGGGTTGCTTGTTCAAGTAAGAACAACA
GCTTAGTAATGGCCCACCCACATATCAAGTTATTAAAGTAACGAACACAAATCAACTCAA
CATGATGAACATGACTATATAGAAATTCTCATGTGTCCTCGGGAGCGCTTGCTTCATATA
AGAGTACTTTCAGGCATGTCCTTTGCTATAAAAAGAATTAGGCTATCTTGCTGCATAGTT
GTTACTATTGTTACTTGTCAATTGTTATGAATTATCTTTATACCAAACTATTTATGATTG
CTACTCATAGTACTTGCAGAGAATATCCTTGTTGAAACTGCTTATCATTTCATTCTGCTC
CTCGTTGGGTTCGACACTCTTACTTATCGAAAGGACTACGATTGATCCCCTATACTTGTG
AGTCATCAAAACTCTTTTATGGCGTTGTTATCGGGGAGTTAAGCGCCTTTGGGAAGGGAA
AAAATCCGATATGTGCTGAAATTTACTGTCGCTTGTTACTATGGATGGTCACCCTTTGAG
TGGCTTGTTCAGGGCATATTCACCTCGAAAGCAAGTGGAAAAGGTTGTATTTCAACCTAG
TGAACCTACTGAAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved