Hordeum_vulgare Locus poly:3:snoR44_J54
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:3:snoR44_J54
Hordeum_vulgare
poly:3:snoR44_J54
chr7H
snoR44_J54, snoR44_J54, snoR44_J54, snoR44_J54, snoR44_J54
1001..1103, 1189..1288, 1433..1533, 2344..2443, 2564..2664
3663
GAAATGTCATCGAAAGAACATTTGGTGTTCTGAAGATGAAATGGCGAATTCTCGAAGGC
ATACCTCGGTACAAACCGGAGACCCAAAAAATGATTGTCACTGCATGCATGTGTCTCCAC
AATTGGATCCGTGATAGCAAGTTACGTGATGAGCATTTCGACAAGTTTGACAATGATGCA
TACGTGCAACCTGTATTGCCGTTTACAGGTGCCAACGCTCTACCACCAGAAGATGATGGT
ACCATGAACGCAACACGTGAGGCGATTGCTGCTAGTCTTGTACCTTGAGAGTATTGTCTT
TTTTTAGTTTATGCACTTGTCGTCATGAACAAAACTTTACACCCATTGTAATATTTAGCA
ATTTTTATGCCATTCGTAAAATACACTTTCGTCACTGTTAGAAACAACAAGTGTTAACAA
TTCAGCAAACAACTTCTATCTAAGGGCAGTACAGACATTTCAACAGACAACACTTTTCAG
AATCTCAAACTACAATCTCTGAAAAGAACTCGACCACAGATTCTGGAAGAAGCAGATTCT
GGAAGAATTTTCCATAATCCTGATTCTCTAGAATCCAGGGTGAAAAGAACTGGGCCTTAC
TCAGACGACACATTGAAAGTCGAAAAGGAGTGAAGAGAAAGAAAGAAAAAAAGGGAGAAT
TCACTTCGGCCTTCTTACACAACGAGGCCCAGCCCAGTTACCATTCAGCTTTTTCCCTTT
ATATCCCCCGTCCCCTCCAAACCCTAAATCCTCAGCCCTCACTCGTCTCCAGCCGTAATC
ACCTCCCCCACACCCCCACCCCCTTCATGCGGAATCACACCACCCATCAGCCATCTCAGC
TCGAATCCCTCATGATTCTTCGATCTATTTCGTTCTACCTGCATTTCTTAGTTTTCTATG
CCTGCTTCAAATCAGTTCTTCGCCTTCCTTCTGTGTTGCGGGGATCTCATCCGTAGAAGA
GGATTAGGAGCGCGATGTTTCGCCGCGCGAGCAGAGCAGAGTTAGCAGATGACGACAAGC
AAGACAGGGACTCTGCAGCGCCCCCGATTTCGGATCGGGGGTCGCGAATGATGCATTCCG
TCTAGGGGAATCTCCGATGCTCGTTCTCGCTTTCCTCCCGCGCATCGTGTTTGTTTTTCG
ACTGCATCAAGTTCTGTCCCGAGTATTTCGCCGCATGAACGAACAGAAAATAGCATATGA
TGATAAGCAAGACAGGGACTCTGCAGCGGCCCCGGCTCAGACCGGGGCCGCGAATGATGC
ATTCGTCTAGGGGAATCTCTGATGCTATTCCGGTTTGCACCGTCTTATCTCTCGGTCTAG
GACTGAACGGATCTGGATCTGGCCGGTGCTTGCTAAATTGTTTTTTTTGCTTTGAATTTG
AATCAGAACGGTCTCTGCCAAGTTTTTGTGGCAACAAATCAGTACGAGCATAACTAGCAT
ATGACGATAAGCAAGACAGGGACTCTGCAGCGCTCCCGATTACAAACCGGGGGCGCGGAT
GATGCATCCGTCTAGGGGAATCTCTGATGCTACTTTCCTTTTTCGTTTTTCCCCTTGCAT
TTTCTTTCGTCTCTCTTCTTATGATGTCTTGAATTTGGTGCCAGTGACTGGTCTCTCGCA
ATGGATTCTTGTAACAGGATGCGCTCCCTTGTTGAGATAAGGGGGCCGCACTGAACTGCC
AGCCTGATGATTATCCTCAAGAACGGAGATCTGAATCCATTTCTCCGTTGAAGCCTGTTT
GGCTGCCGTGCTTGATCTATTGCACCGCTTGTTTCTTGGCTGGGTTTCTCTCAGGAGTAA
ATTGCAAAGAAAGCAACATGCTTGCTTGCTTGCTTGCACACACACACACATGTACGCACG
AAGCGGGCCAAATGGGCTCCGGGAATGGACCTGTAGAAGCAAACTTTATGAAGGCTTTGG
CAGATCAGATTAATGCTATGATTTATGGTATACTTGTTTAAGTAGCATACTACTGCCCAC
CTTCAATGGTTTAATGCCTGGTGTTTTGCTTTGGAAATCTTCATGCGAATATTTATTTGG
ATCTGAACATAACTTATGTGTGAATTGTAGTGCTTATGTTTGGACATAGCAACATTAGAA
GAAACGAGAATCAAGGCCAGGGTATGTAAAGTGTATTTGTTTATCAAATATGGAACCCCT
AGTCTGCTTGGCTAGCCTGATGATTACCTTTGCGTAACGAATAAAGTTCTGAGATCTCTG
CTTAGGCTGCTGTGGTGGATCCTACTCCCTCGTTCCATCAAATTTGGTCGCCTAACTTCC
CTCTTGTGTTATATTTATTTTTGATTTCATCAAATTGGGTGAAGTATTGCTGCACGAACA
TAAATTAGCATATGATGACAAGCAAGACAGGGACTCTGCAGCGGCTCTGACTCAGATCAG
GGGCGCGAATGATGCATCTGTCTAGGGGAATCTCTGATGCTAATCTAATTTGCAGTATCT
TGTCTCTTTGTCTTGGCCTGAATGGGTTTGAATCTGACTGGTGTTTTCTAATAGTTTTTC
CTTTGTAACGGTGTTTGCTAAATTTGTGTTTCAACAAATCACTATGAGCATATGATGACA
AGCAAGACAGGGACTCTGCAGCGCTCTTGATTTCAAATTGGGGCCGTGAATGATGTATCC
GTCTATGGGAATCTCTGATGCTAATATCCTTTTCGTTTTTTACCTTGCATTTTCTTTCAT
CTCTGTTCTTATTTTTACCTCTATTTAGCAGCCTGTAACTGTGCTCATGACAGGCTACAG
CTGTTAGTAATGAATTCACTTAACTGGAGCAATTTGTTGTTGAGTGAACAGGATGCACTG
ACTACCAGCCTGATGATTATCCTTGAGAATGGAGATCTGAATCCACTTCTGTGTTTGAAG
CCAGCTTGGCTGCCGTGCTTTACACCTATCCTGGTTTCTTGGCTGGCTTCCTCCAGGAGT
AAATTGCAAACCCCCCTACGTGCATCCATGCATACAAGCACCTCACACACACATACATGT
ACGCACGAAGCAGGCCAAATGGGCTCCCTGAATGGATGTGTAGAAGCAGATGTTATGAAG
GCTTTGGCAGATTGGATGGATGCCCCCACTAGATTCATGGTATCCTTGTTCTAGTAGTGT
TTGGCATCAGTTTGAGGTTGCCCACCTTCAATGGTTTAATGCCCTGGTGCTTGGAAATCA
TCATACAAAATATTTTTTTGGATTTGAACATAACTTATGTGTGAATTGTAGTACTTGGCC
ATAGCAAGATTACCTGATACGGGAATCAAGGCCAGGATATGTAAAAGTATTCGTTTATCA
GATGCAGAACCTTGTGTGCTTGGCCAGCCTGATGATTACCTTTGCTTAAAGAATGAAGTT
CTGAGATCTCATCTCCGTTGAAGCTCGTCTAGCTAAGGTTGCTGTGGTGGATCCTACTCC
CTCCTTTCCTAAATAATGTACTCCCTCCGTTCAAAATATAAGATGTTCTAACCTTTTGAT
CTTCCACCAACCTGGCTAGCTGGGCTCCGGAGTGAGTATTTGGAGACATAAAAACTATGA
AGGCTTTGCTAATTCGTAGAATTCTTGGTTCTGGATTATTGTTCTAGTTGAGAAACTTGT
TTGGACTGTGTATTAGCTATCTCAAATGCACAAATTCTTCAAAGTAGTTGTTTTTTCTTG
TTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved