Hordeum_vulgare Locus poly:3:snoR44_J54
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:3:snoR44_J54
Hordeum_vulgare
poly:3:snoR44_J54
chr1H
snoR77, snoR77, snoR44_J54
1001..1137, 6338..6472, 6547..6640
7640
AGCCAACCAACAAGTGCCACATGACCTCATTTCCATCTAAAAATAATAAGTGGGTCCTC
ACCTCCATATCAAAAAAGAAAACCCTCACCTCCTCCATCTTTTCTTAGAAAAAAAGGAAA
ATGCAAAAAAAATAAAATACATTTCCACACCAGCCAGCCAGTAGGCGCCACTTGACATAG
CCCAACGCTGGCCCTTTCTTTCTCCCCGGCCCTTGGACAGGCCCAACACTCTATACCCAG
CCCATTGTTCCTACGAACCCCTCCCTCCTCTATTTATACGATCCGGTGAACGAACCCTAA
TCACCACCCCGCAGCCGCCGCCAGCGCTCCTTCCATCGCCATTTGCCTTTTCTTTTCTTT
CGCCTCTTCTTCTTTTCTCGTTGGTTCCTGGTAGTATTATCGATGCGATGAAGAGCTAGT
TTCTATTGATCCGCCGCCTTGGACGGCGGCGGCGTGATGCTCACCATTACTACTGGTTCG
TATTCACCGAGCATCCATCCAGCCAGATCGCCCCTTCTTGTTTCAGACTCAGTTTTCTTT
TCTCTCGATCCAAACATGTGTTCTTGCAAGCTTCGTAGGTTTTTGTTCTGGTTACGGCGA
AGATCCCAGCAGAGAGGTGTTGAATCTCCCTCGTTGAGGCCTCTCTAACAAATTTCTAAT
CTTCGCACAGTGACGAGACGCCGTGGATTTTGTGGGTGTGTGATTTTCCTGGTTCTGTCA
CATCTGTTGCCGCGGATACATCTTTTATCAAACTACTAGTTTCAAACTTCATTTCTTTTT
GTTTTGCATCCGAGGGACCTATGGATGGACAGCCATTCCCGTGCTGTGTCTACCAAGTTT
GCCTTCGGACACTACCAAGCAGATTGTTCTTCAATCATCTTGCTTCAAACTCTCTTTTCT
GTGAGATGGAATCATTTGCTGACATTCAATTTATGTCTAAGCCACTGTTTTTTTGTTCCT
TATTTGTGGTCTAATAAAAGAGACCCAACGAGCGACGATTCAGGCAGCCCCTTTGTCCGA
TTCAATGGCAATGGAGGTGTTGCGTTGCTCGGAGACTAAATCTTCTGCTCTTCAGATTAG
CTGAGGGGGAGGCACTGCTTCCCTCCTTGAAGCTGGTCTAGTAGTCTTAAGGACATCAAC
TTAGTTTTCCTTTGTAAAACATTGTAGTTTTGTGACGAGCGACGATTCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGAATATGAACGGATGTTTTTGATTGAAAAATGTTGACTGCTATAAACAAATGAG
AGAATAAAAACTATGTAAAAACAATCAAATCAACCATTCACGCACACCTATGCTGTCATT
GCCTAGTGAAGCTTATATCAGAACAAATGATGTCTTGATTATCCTTGATAAAACAAGTGA
AGCTTATACTATTATCCTTGTGTGAAAATTAATTATCCGTTGAATAATATCAATCTGAGG
GACACCTTTTTTGAGGTTTTTATTTTATTTTATCTTGTACTGGACCTGATGCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATACTTTCGTTCTTCTCATGTGCTATCTC
ATGGCGCGGTGCGGAAGCAATTTGGAGACCTGAACTGAGGAAATGCTTTTATCTTTCTTA
CCCAACAATTGCCAATTTTACTATTTATTTCATGTTTTTCCTCTTGTAGTTTGTGATGAA
GAACATGTTTTGTGTTTGTTGCTTGACAACTGGATGGATGGCCTATTGTTAATAGTTTGG
CCATCCTGTAGAGGGAAACATAGATGAACGGAGACACCGGCCAGCATTAAACAACATGAC
GCTCTATCAAACTGCGTCTTGTTACCTGTCTTCTGTCACATTTATAACATCTACGTATTT
TTATTTACTAACATTTTATTTCTTTTGTACTTCCTCCGCCCGAAAATAAGTGATTTAAAA
ATGACTTAACTTTGTACGAACTTTATAAAATTGAGTTNNTTTTAAGTCACTTATTTTGTA
ACGGATGGAGTTGCTTTTTAGTGCATTGCATTACAATGTGCTTTGGTCGATTAAACTTGC
AGAACCCTCGTAGAATAGATATTGCAGTTGAGTAATTGGTGGGCTCTTATTGCAGCAACA
ATTATATTAATTCGTAAATGCAAATCTAGTGTCATCAAATTGATGCATGGGAATTTAACT
TGTGTGCATGGAAAATAAGAATCTGTTTAAGCATCAATTTCTTTGAGCAATCAATTAGTT
TTGTCCGGTGATGATCGAACTAAATACATACTTTCATTCTTCTGATGCGCTATCTCATAG
GTTGGTGCAGAAGCGATTTGGGGATCTTAACTGAGGAAATTATTTTTTAGCATAGTGTTG
CAAATAGAAATGATTTTCCTTTCTTTTATACTTCTTTTTGGTATCACATCTCGAGGAATG
TCCTGACATAAACAGTTTTTCCTCTGAAACTGCACACATTTTACTTAACAGAGTTTGGAA
ACAGCCAGAAAGACCAGTACATGATACGTTTGCAGAAAACTTTGTAGAAATAACTCACAT
AATACTTTGACCTCTTTGATGATGAGCGATGATTCAAGCAACCTCTTTATCTGATTTCCG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTGTTCTGTGACGAGCGACGTTTTAGGCAGCCTCTTGCCATTGCAG
TGGCATTGGAGGTGTTGCGTTGCTCGGATAGTAAAACTTTTGCTATTCAGATTGGCCGAG
AGGGTGGCTCCTGCTCCCCTCCTTGAAGCTGGTATAGTAGTCTTAAGGACATTATTTATT
GTCAATTTGGTTCTCATACCCAATTTGATATTGACCTTTTACTTCATTTCTTGTTTCGGG
ATCAAAGAAAACAAATGATGATAGCAAGACAGGGACATCAGAACCCAGAATTTCAGGGTT
ATGACACACTATGTCTATAATGGGAATCTCTCTGATGTTTTTTATTTCCCCAAGATATAT
CTGTTTTGGAAACTGGCTTTCTTTCTCGTCGGCAATTCGGATCTTTGATGGTAGTACTTG
GAAGCAGGCCATGGTCGACCTTATCAACAACATTGGGCGGACAACAGTTACATCCAGTGA
CATCTAAAGACGTACACTCTTGGCAACTGAAGCTTAATNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNACATGAATATGAACGGATGCTTTTGATTGAAAAATGTTGACTGCTATAAACAATTGGC
GGAATAAAAACCACGTAAAAATAATCAAATCAGCCATTCATGCACACCCATGCTATCATT
GCCGAGTGAAGCTTATATCAGAACAAATGATGTCTTGATTATCCTTGATAAGACAAGTGA
AGCTTATACTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTAAGCAT
CGCTACGGGAGAGAAAGTCTCATCGTAGTCAATTCCTGGAACTTGTGAAAAACCCTTTGC
CACAAGTCGAGCTTTATAAACGGTCACATTACCGTCAGCGTCCGTCTTCTTCTTAAAGAT
CCATTTGTTCTGAATAGCCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved