Hordeum_vulgare Locus poly:3:Plant_U3
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:3:Plant_U3
Hordeum_vulgare
poly:3:Plant_U3
chr7H
Plant_U3, Plant_U3
1001..1221, 3920..4140
5139
NNNNNNNNNNNNNNNNNNNNTGCGTCGTGTTTGCAACGTCTTTGTACTTGTATGCGTGT
TGTCGTCTTGTTAGAGCCATCCATTGATAGGAGATCATTATTATCTGTCCTTGTCTTCAC
CGGTGGCCCGTCGTCGACATTAGGCTACCTCGTTTAACTCACACGGATCGAGCAGTGTCA
TCGTGGATTGTTTTTTGTCTCTCGCTAGTCATTTGGTAATACGTACAAGTAAACTCTGTA
GAAACTAATTAGGATTCCCCACAAAAGAAAAGAACAAACCGTTTAGAATCCATTGAAAAA
ACATTATAGAAAATAATTCAATTCAAAAAATAGAGACCGATTGGAATACTGCTGGCAGTA
CAAACTGTTGTGTGCTAGTGGACGGAACAAGTGTAACAGCGTTGGCATTTGTTTTTCCTA
GACTTGAACTTTGAAAATTTTAGAAGCTTCAAATAATCAGAGCAGACCCCTCAGAAAAAA
AGAATGGAGGATTAACTAATGACTAACAAAAGAATACGAGCAGTGATAAACAAGGCATCA
TTTAACAGATTTTTGAACGGAAAGGAAAAATATATTGGGAAAGAACGAAATATGTATTTC
TTAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNATATGTATTTCTTAGATGGAAAGCAAAAGAAAAAAGGAAAG
CAACGCGAGATATGTATTTCTTAGATGGGCCGGGCTCTGTTTATTCTCCAGCAGACCTTC
ACGGGCCAGGCCAGGTGCCAGGAGCCACGAGTCCTTCACGTCTTCGGCCGCCGAGAAGGC
GCTGCGCGCTGCAGCGTTTGCATCCCCACAAGTTTAGTCCCACCTCGGGAGCTTAGAGCG
ATTCGCACCGGTTTATAAGGCGGGGCGCTGAGGATGGTGGCACGACCTTACTTGAACAGG
ATCTGTTCTATAGGATCGTACCGCTGCATCCTTTACTAATAAGGAGGCAAGCACTTCAGT
CTGGTTGATGCATTCTGACCACTGGGCCAGAGCGTGATTAACGGCCAGGATTCATCTGAT
GGGTGGATCCAACGGCTGTAGAGGATCGTTCCTGCCTGGCTCACGCCTGTGCAGGGTGGC
CCAGTGGTTGTCTGACAGACACACATAACCTTTTTTTTTTTTTTGCCTCATGCACGCACA
GAATCTTGTTCCAAAGCACGAACAACATGCTGTTTTATTTCTGAGCCCTTTAGCCACAAA
AATCCTGTTTGTTCAGAACCATATCTGATCCCTTTTTTAGCTTCTTCAACCACAAAAACC
ACATTTGTAATCACATGGCCGAAATTCCGTATTATTCAGTTCATAAATATAGCAGTGGCA
GTCTGTAGAGCTAGCCGCACCAATGTTTCACTAGTGCTGCTGTTATCACAGACAAGATGT
GTGTCAAGTGTGGTAGTTGCCCCAGAACAATAAACCAAATCAAGTTTAACCATCGCATTG
ACATCATCACCTCTTTGCGCGGCAGGCTCTCAAGAACCCAGCCAACTGGGTTTCAGTTTA
CAACACCCACCATCATCAGTATTACAGATGCCATCATCGGCGCGCTCGCTCGCTCGACCT
CAAACTTTGTTTGAACAATCAGTAGAAAAGAAGTAGTAGCTTCAGCGGCTCCTGACGGGG
GCGAATAATAACCTCTTGTAAGTTCAAAAAAAGATGGCATGGTCATAGCAGACACTGCAC
ATATGGGGACAGTCAAAGATCGGCTCACTCGATCACTATGAAGGGGGGCACCTACTTGAT
GCCATGATTTTTTGATTGGCTGTATTCCCATGTGCTCGAGAACACAAGCATTTACAAGAT
ACAGCACGCCAACTCAACCTGAGCATTCTAGCACCGAAAACTGCTCATGGTGACGCATAT
GTGAGCCTTCCCAACGTCGTCAAGGTTCAGATATACCATCTGCATTTCAAAGTTTGCGAT
TGGTCAGTCAGAGCAGTCCAAGTACAGGTCTTAACTGGAAAGTAAAGCAACCATGCAGCA
GCAGGATACTTGAGATTCATGTATTTGTTTATCTGAACTGATAAAATAGCACTCACATCC
AAATGTAACGTCTTCAGGCGGGGCGCAATATCTAAACAGTGGGCACGTTGAAGAACTCTA
TTATCTTGGCTCTCTAGGGAAGACAGCTAATTGACAAGTCATATGCCTCAAATGTCAAAT
GCATATGCATAAACATGTCATATGGTCTTTGTCAGGTTCTGTAACTGAAACATGGCCAGG
ACAAAAAAGATGCCATTAAAACGCAGTTTCAAGACTATAATGTAGGCAAACAAGATGAAT
AAACTGATTAATGAACACCAGGTAACCTGTTCATATCCATGTATGTGAGCTTTCATATTT
AGTATTTTCACTTGCAAAATGCTTGGAGCTAAAGGGAAAACACGGGCCAGTCCTTTGCTG
CCTTTAAACATCATTGTAGCCTTCTCTGATTCTGAGCAACCATGAAGTACTATAGGGATC
TCTTGTCCTTCGTATTGAAAATGAGCAAGATCAGCGGCATGAAGCCCAACCATCTCGACA
TTCATTCCGTCAATTAGTAAATGTTGAAGCTTGTCAACCTGGTTTGGTATGCTTTAGTTA
CTTGCACCAAAGCACTCGATGATCTCTAAGTCCTCAAGTGCTGAACTGTTTGCTAGCAAA
CCTGGAAAGTCTCCAAATATCTGAACATATTCCAGATTATGTCTTCTGAGTACTGTGAAG
CCACATATCTCTACTATTAAAGGGGGATCTGCCGTCGTCGTGATGGTTCAACCTCACCCT
TGGTTAGACCTTCGGCGCGACGATAAGAAACCCACGTCCCACGACCGAGTGCAGAGAGAA
AAAACCGCGCTTTCTCCACCCCACGACCTACCTCCCCACGTCACATCCCGCGGCTGACGC
TGCTCTCCTCTCCCCCGGCTCCCAAATGGCCGCCGCCGCCTCCTTCCTCGCCGCTCCCTC
CCCGCTCACCCACCCGCTGCGCCCGCGCCATTCCCTCCGCCACCTCGCGCGCGCCGCGGC
CGCCAGGCCGCCGACTGGCCCCCTCGCGCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTCTTCTTTTGC
TGCTTACTTGCTGGGCTGGAGGAGAGAGCAGGAGAAGTAGGAGGAGCTACTTCGTCGTCA
TTTTCTCCGGCTCCGGCCATTGATGCTGCAAGATCGGTGGAGTCCAGACGAGACTTTTTT
TTTTAGGGGATGGAGTCCAGGCGAGGCGAAAAGGAAAGCAACGGGAGAGACGACGGTTGT
TTCTTAGATGGGCTCGGCTCCGTTCATTCTACAGCCCAACTTCACTGGCCGAGGCCCACA
CGAGAAGGAGGCGCTGCGTTACAGCGTTTGCATCCCCNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGCGTTTGC
ATCCCCACGAATTTAGTCCCACCTCGGAAGCTTAGAGCGAGCATGACCGGTTTATAAGGC
AGGGCGCTGAGGATGGTGGCACGACCTTACTTGAACAGGATCTGTTCTATAGGCTCGTAC
CGCTGCATCCTTTACCAATAAGGAGGCAAGCACTTCAGTCTGGTTGATGCATTCTGACCA
CTGGGCCAGAGCGTGATTAACGGCCAGGACCCATCTGATGGGTGGATCCGACGGCTGTAG
AGGATCGTTCCTGCCTGGCTTACGCCTGTGCAGGGTGGCCCAGTGGTTGTCTGACAGACA
CACAAATCCTTTTTGTATTTTTTGCCTCTGTCAATCTTACCAACAGATAATATATTGGTC
TAAAAGATTCAAAATCCTTTTTATCTATGCCTCTAACACCCTTCTGTCCTTTCCTACCTA
CAGAATATTGGTCTGAAAGATCTATAAATAAATCAGCAGTTCCATCATTGGGCTTCTTTA
ATCACATAATCTAGTGGATCATACATTCTGAAAATCATCAAACAACCAACCCAAATGGTT
CCTTTTTTTTTACATGAACTAAAATGATTCGCCGGTGCTTCTTATGTTAGACATGAGATG
CAAGTGTGCACTTGTTGCCCCCAGAACAATTCAATTCAACAAGAGTAATTAACCCACAAA
AAATATAAACTGCAACAAACCATTGGTAAAGCTGTAAATGATCCTGATACACGCTGGCAA
CCGATGAGCGTTACAGGCTTGAAAATAAGAAAAAGAATGTTTGTTTGCTGGGATGAAGCT
GGCAGCCTGGACCGCCTGGTTGAGATTCAAAATCATCTTTCCAGCATGCAAGAAATTCAC
GCAAAAAAACAAACAAACAATGGTGATGCATAATGACTCTTCCATTAAAGAGTTGCATCA
ATACACTCGACGGGGGCTCCCCTACTGTTCAGGGTCAAACACAAATTCCATTGCGATTTC
ACGCACGGCAACAAGGCTGTAGACTCGCCTGATGGTAACAGAACCTTCAGTTCTACATCT
CACTATAAAGAAAAGAAAAAAGAAAATCTCGCTTCTAATCCTCGACCAGCAAGGTCATTT
GCCTCAAAGCAAGGAAACACATTGCTGGGAGGAAGGAACTAGAAGTTCGGAGGCGACACC
ATGGAACCTCTCTTCTTCTCATTCCAAGGCCAACTGGGGATAACTGAGCCAGAGATTCAA
CCATCACATCAGCAGTACAGTGAAGGAGGGACTGGTGCGGCGGTTTCTCTCTCTGCAGGT
TTCTTTGTCGACAAACCCTGCTCCAAGAAAGATGATAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved