Hordeum_vulgare Locus poly:2:snoZ43
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:2:snoZ43
Hordeum_vulgare
poly:2:snoZ43
chrUn
snosnR60_Z15, snoZ43
1001..1095, 2455..2557
2102
GCCTCGCCGAAGCGGAAGAGATCGATCCCCGCCTCCTCCGCCTCCTCTCCGGCAGGTGC
CCGCCGCATCTTCCGCCTCGTCTCCGGTGCGCCTTCTCTCCGGCAGGTGCTCTCCACGTC
TCCATGCCCTCCATTCTCGGCACCTCTTCTGCTCCTCCACCCTCTTCGCCTTCTCTCCGG
CCAAGCGGGTGCTCTTTCTGGAGGTGGTTGACTCCCCGCCGAGGGAGGGCTAGAGCTTCT
CCTGCTAGCCAGTGTACAAGGAAATGGAGGTTCTCAAGTCTGCGAGGCGTGTATCCATCG
ATTGCACCGACATGTTTGTCCTGGACAGCGAGAGGAGCAAGAGGAAGCAGACAGCTGCAC
AGTTTTGAGCCAACTCTGTCACCACACAAAATACTTAGATAAACACATCTGATACGAACC
TGTGGCTGTAATTTGCGATTACAAATTCCTTTGCATGCTTAACCATAGTGTAGGAGTTGT
TGTTGGTGATGATAGAAAACTTAGGCTGGTTTCTCAAAACGTCTGCAGTTGCCGCCTAAA
TTGATTTAGTCCTTCCAGGCTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTATTTGAAATAATT
GGACACCATTTGAGAAAATTGGACCATTTGATTTTTTGAGAGGACAGTAAAGATTGATAT
TTGGCCAGGTTCGTAGTAACTGGCATTTGTTTGCCTTGCCGACCATACTGCTAGTGCTAT
ATCATCACCTATATTCCGAGTCCTCTAAATTAATTTGTTTGATGTTNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNATTTGTTGGAATCTGGGCCCACCATTGCTTCTTC
ATAATTTGCAGGTTCATTGTTGTCTAACAACATGATTGATAAGACGGGATTACCGTACCA
CTCTGGAGCAGCGCGTGATCTCGTCGACCTGCGTGGTTCAACAGAAACTTGAACTGGAGT
TTCATGATCATCATCATTAACTTCCTCCTCAACCGGTGTCGCAATCACAGGGGTTTCCCC
TTGCCCTGCGCCACCATCCAGAGGGATGAGAGGTTCGACAACCTCGTCAAGTTCTATCTT
CCTCCCACTCAATTCTCTCGAGAGAAACTCCTTCTCGAGAAAAGTTCCGTTCTTAGCAAC
AAACACTTTGCCCTCGGATTTGAGATAGAAGGTGTACCCAACTGTCTCTTTTGGATAACC
TATGAAGACGCATTTTTCCGCTTTGGGTTCCAGCTTTTCAGGCTGAAGCTTTTTGACATA
AGCATCACATCCCCAAACTTTAAGAAACGACAACTTTGGTCTTTTGCCATACCACAGTTC
GTATGGTGTCGTCTCAACGGATTTTGATGGTGCCCTATTTAAAGTGAATGCAGCTGTTTC
TAATGCATAACCCCAAAATGATAACGGCAAATCAGTAAGAGATATCATAGATCGCACCAT
CTCTAACAAAGTACGATTACGACGTTCGGACACACCATTACGCTGTGGTGTTCCAGGCGG
TGTTAACTGTGAAACAATTCCACATTGTCTTAAGTGAGCACCAAACTCGAAACTCAGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved