Hordeum_vulgare Locus poly:2:snoZ221_snoR21b
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:2:snoZ221_snoR21b
Hordeum_vulgare
poly:2:snoZ221_snoR21b
chr2H
snoZ221_snoR21b, snoZ221_snoR21b, snoZ221_snoR21b, snoZ221_snoR21b, snoZ221_snoR21b, snoZ221_snoR21b, snoZ221_snoR21b, snoZ221_snoR21b, snoZ221_snoR21b
1001..1093, 1496..1588, 1839..1931, 5489..5581, 5984..6076, 6327..6419, 8486..8578, 8981..9073, 9324..9416
12415
GAAGTACTACTTCTACCACATGCTCTCGTGGCCGCAGCTGCTGTTCGTCGCCGAGGACT
ACGGCGGCCGCATCGTCGGCTACGTGCTGGCCAAGATGGAGGAGGACCCCTCGGAGCCCT
GCCACGGCCACATCACCTCCCTCGCCGTCCTCCGCTCCCACCGCAAGCTCGGCCTCGCCA
CCAAGCTCATGTCGGCCGCCCAGGCCGCCATGGACCAGGTCTTCGGCGCCGAGTACGTCT
CCCTCCACGTCCGACGCTCCAACCGCGCCGCCTTCAACCTCTACACCTCCACCCTCGGCT
ACCAGATCCACGACATCGAGGCCAAGTACTACGCCGACGGCGAGGACGCCTACGACATGC
GCAAGATGCTCCGCCAGCCCGTGCCCAAGAAGCACCATCATCACCACCACGCAGGCGGCG
GCTGCTGCTCTCATGACGCCCTTCCTGCGCCGGCCGGATCGTCCCCGACTACCGCTTCGC
CGGAGAAGAAGGCCGACTCATAAGAGGGTATGCTGCTGCCGCCTCATCGATCTGTTACTT
TTTGTATAATAAACTGCGGTAATTCGATACTTGTTGTTACTTAGAATCAACGATTTCCTG
CAACTTAGTCGCGATTTTGCTAGGGAAATTATCATAGCCAAATCTCGCTGTTGGATCTTG
TGTATGCGGCGCCTCTCTCACCTTTGGCTTCTTGAGATTGACCTTTCTCAAAGTTGCCCA
GTCATGGAGGCGCACAGTGATCACTGGCCGGTTTAACGTGGTTGCTAGCAGTTTGTTGCT
ATGCTTCCAAAATCTCTCGCCACATCTGCTTTAACCATAACAAGTTACAGATTAGATCTC
GTGCGGTTTGATGAACATAAGTTAGTTCTGACCTCTTGCTTGCCGGAGCTATAACGTGCT
CCGGTGCCTCTCTCACCTTTGGCATCTTGAGATTGTTCTTTCTCAAAGTTGCCCAGTCAT
AGTGGCACATAGTGATTCCTGGTGGGTTTAACGTGGGAGGTAGCTGTTTATGGTTATGCT
TCCAAAATCTCTCGCTACATCTGTTTATTAGAACACTCTTTTGAACTGCTGTGGATTGTT
CTGAACCTTGTGCTGCCTACTGTCTGAAGAACATATTTCCGTCCATTGCCTCTTAATCAT
AGTGGTTATATTACTATACCTGAGTTTAGTCAGTGATGATCATGTCTGCAAAATGTATGC
TCTGTGGATTCAAGCCCCTGTTTCAGGGAGAACCTCTTGATGAAGCAGATGTAATTTGAC
ATTAATTGACAAATCTGAGACATTGTTGAATATTGTTTCATGCTGCCTAGTTAATTTTAG
TAGTACGATTGTATTGATTTGATTTCTGGTTTAGAAACAGTCTTTTGCTGCATGATAGCT
TGATTATTGTTTGCTTAAGTTCTGCCATTGATGATTCTGTCTGCAAAATGTATGGTCTGT
GGATTCAAGCCCCTGTTTCAGGGAGAACCTCTTGATGAAGCAGATATAATGTGACATCAA
TTGACAGCTCTGAGGCAATTTATAGCATTGTTCTGCTTACTGCCTTGTCATTTTAGTAGG
TAGGATGTATTGAGGTGACTTTTGATTTTGCAACTGTCTCTTTTACTTGATACCTTAACC
GTTGTTTGCTTAAGTTTTGACAATGATGATTCTGTCTGCAAAATAGATGCTCTGTGGATT
CAAGCCCCTGTTTCAGGGAGAACCTCTTGATGAAGCAGATATAATATGACATCAGTTGAC
AAATCTGAGACAATATTATGATATATTGCTGCTTGGTGTCTAGTGACTTTTATTATTCAT
GGTTTTCCAATGATGATTCTGTCTGCAAAATGGATGCCCTGTGGACTCAAGCCCCTTTTT
CAGGGAGAACCTCTTGAGAAAGCAGATGTAAAATGACATCAAATGACAAATCTGAGGTAT
TCTATATTGTGCTTCCTAGTATTTGTAACATCAATTGACAAATGAGGTATTCCAGGACAT
TCAGCTTCCTGCTGATGCAATAGGCTATGATGAGAAAAGTCATGCACCACTCTGAAGAGA
ATCATCTCTTTGTGCTGATAAACAAACTTACAACCCATTTTACATCTGAGCCACCTCATG
GATACCTCTTTTTGTATTTTTTCTTTATTTGCTTTTCATGCCATAGATGGTACTTCCTCT
GTCCGTAAATACTTGTCATAGGAATTAATGTATTAGATCCTTTTTTATTAATTTGTGCGA
CGAGTAATTCCGGAGGGAGTAGTTTTTATAGTTTAGTTGGGGGAATGATGTACAGAACCA
GATGACGAGGGTTGCCCAAATGCAATCCTACCATGATGCGGACTGAAATTTCATTGAGGT
CAAATACATTTGCTGCTGATGGTTCTTCACAACCCCGCATATTTTGAATGCCATGCTTTT
CTTGGTAAATTGTTTTGTGAACCTTGTTGCATTGCATATGAATTACCTTGTTTTCTGTTG
ATAATTATGTCTGCAGTGCGTGCTCTGTAGATGCAAAGGCTATGATGAGAAAAGTCATGC
ACCACTCTGAGGAGATTTACCTCCTTGTGCTGATAAACAAACTTACAACCCATTTTACAT
CTGAGCCTCCTCACATTTTTGTATTTTCTGATTTATTTAGACGTATGTCAAATTGGTTTT
TGAGAAACCAAATAGTTAAGGTAATAACTGGATTGGTGGGATAATATCGGAACCAGATGA
TGAGGGTCGCCTATTGGTGATCCTACCATGATGCGGACTGAATTAACATTGAGGTCAAGT
ACATTTGCCGCTGATGGTTCTTTTTCCAATCCCCCCATATCTTGAATTGATTTTCTCCTT
GGTTTTTGAATGTTGTTGTTGGCTATGATGAGAAAAGTCATGCACCACTCTGAAGAGATT
TATCTCTTTGTGCTGATAAACAAACTTACAACCCATTTTACTTCTGAGCCGTCTCATGAC
TTTTGTATTTTTCTGATCTGTTTATTGGTTTTTAGAAAATGTTTCCAGCTTTTGCCTTTG
TCAGAATACTGTGGTTTTGAAAGATAAGTCTTGCTGTTAACTGGATTGGACGAATAATGT
AGAGAACCAGATGATGAGGGTTGCTCTAGCGATCCTACCATGATGCGGACTGAGTTACAT
TGATGTCAAAACATTTGCCGCTGATGGTTCATCTTTAATGTTTTTTGTCATCCCTATTTT
CAGTGTTTTGGAAGGAGTGCCCTTGTATCTGAATTACTTAAGGTTNAACCCTCAAATCCA
TGAACGTTGATTATATAGCACAAATCCATCATCAGTCTAACAATTCAACAATGCAACATA
GAGCAAAGCGAACCACACTTTCAAAGTCGAAACATGTGAAAACTGAAATTCAACTTCCGA
ATTGTGTCCCGCCGTTGGAGTCAGTTTAGCAGTTCAACATGATGAATAAAAAATGTAGAG
GCAATGTTGTCATGCTGGTGTCACCAACTGATGGAGCCGATGAGATTGCCAAATCATAAG
CCTTGTACTAGTTAATTGGTTAAAAGTTGTGTTACGCAAAACATGTTTCAAACGAGCTTC
TATTATTTTGAGAAAACTAATTATGCACATGTGTTGACATGTGCAGATGAATTTGTAAAT
TGTATCGAGCCTGAACATTGTTTGAGAGCAACGATGGTAGCATGCATCTACATAGAATGG
TACCATATTTTAGGAGAATGGCAGCATCCATACCGTGCTTCATCTATCTTGTATTCGCTT
CAAGAAATATCAGGAAAATATACAAGTTAACTAAAATAGCTCAATAATAATAATAATATG
GGCCACAATATGTGTGATAGGTCTTTGGAAGGTCCTCCCATCTAAAAATGCATTGTGAAT
TTTTTTTGAAAAATCAACTCCACGCCCTTTGATCAAATTTATATAAAATGTTCATCACCA
ATATTTAATCTTGAAGATGTTTTAAAATCCTTCGATTGTTCATACAAATTTTGCAAACTC
ACATCGTTTTTTAGTCTATTTATATTGAGGTACTCCCTCGTTCTTAAATATAAGTCTTTT
AAGAGATTTTACTAAAGGTCTACATACGAAGCAAAATAAATAAATCTATATACTTTAAAA
TATCTCTATATACATTCGTATGTAGTTTACTAGTGGAACCTCTAGAAAGACTTATAATTA
GGAACGAAACGAGTATTTTTTAAGAGTTTGGACTTTTTTTGTTATGGTTCTGTATTGGGC
TAACTTACCTTGGCCCATGGGGCTATTTCGGCCCTTTTCCTCTAGGGTTAGCCGGTTAGG
TCAAGGTCTCTCATCCTTTCCCCACCCCACCTCTATTAATACCCGCCGCCGCCGATTCCA
TCTCCATCACCTCATCCCGCCGGCGATTGCTCCCCACCACCCAACCCTAGATCCATAGAC
CCGGCGGCGGCGGCCAGGCCAAGATGGTGTGCATCCGGCAGGCGACGATCGACGACCTGC
TGGCGATGCAGGCGTGCAACCTGATGTGCCTGCCGGAGAACTACCAGATGAAGTACTACT
TCTACCACATGCTCTCGTGGCCGCAGCTGCTGTTCGTCGCCGAGGACTACGGCGGCCGCA
TCGTCGGCTACGTGCTGGCCAAGATGGAGGAGGACCCCTCGGAGCCCTGCCACGGCCACA
TCACCTCCCTCGCCGTCCTCCGCTCCCACCGCAAGCTCGGCCTCGCCACCAAGCTCATGT
CGGCCGCCCAGGCCGCCATGGACCAGGTCTTCGGCGCCGAGTACGTCTCCCTCCACGTCC
GACGCTCCAACCGCGCCGCCTTCAACCTCTACACCTCCACCCTCGGCTACCAGATCCACG
ACATCGAGGCCAAGTACTACGCCGACGGCGAGGACGCCTACGACATGCGCAAGATGCTCC
GCCAGCCCGTGCCCAAGAAGCACCATCATCACCACCACGCAGGCGGCGGCTGCTGCTCTC
ATGACGCCCTTCCTGCGCCGGCCGGATCGTCCCCGACTACCGCTTCGCCGGAGAAGAAGG
CCGACTCATAAGAGGGTATGCTGCTGCCGCCTCATCGATCTGTTACTTTTTGTATAATAA
ACTGCGGTAATTCGATACTTGTTGTTACTTAGAATCAACGATTTCCTGCAACTTAGTCGC
GATTTTGCTAGGGAAATTATCATAGCCAAATCTCGCTGTTGGATCTTGTGTATGCGGCGC
CTCTCTCACCTTTGGCTTCTTGAGATTGACCTTTCTCAAAGTTGCCCAGTCATGGAGGCG
CACAGTGATCACTGGCCGGTTTAACGTGGTTGCTAGCAGTTTGTTGCTATGCTTCCAAAA
TCTCTCGCCACATCTGCTTTAACCATAACAAGTTACAGATTAGATCTCGTGCGGTTTGAT
GAACATAAGTTAGTTCTGACCTCTTGCTTGCCGGAGCTATAACGTGCTCCGGTGCCTCTC
TCACCTTTGGCATCTTGAGATTGTTCTTTCTCAAAGTTGCCCAGTCATAGTGGCACATAG
TGATTCCTGGTGGGTTTAACGTGGGAGGTAGCTGTTTATGGTTATGCTTCCAAAATCTCT
CGCTACATCTGTTTATTAGAACACTCTTTTGAACTGCTGTGGATTGTTCTGAACCTTGTG
CTGCCTACTGTCTGAAGAACATATTTCCGTCCATTGCCTCTTAATCATAGTGGTTATATT
ACTATACCTGAGTTTAGTCAGTGATGATCATGTCTGCAAAATGTATGCTCTGTGGATTCA
AGCCCCTGTTTCAGGGAGAACCTCTTGATGAAGCAGATGTAATTTGACATTAATTGACAA
ATCTGAGACATTGTTGAATATTGTTTCATGCTGCCTAGTTAATTTTAGTAGTACGATTGT
ATTGATTTGATTTCTGGTTTAGAAACAGTCTTTTGCTGCATGATAGCTTGATTATTGTTT
GCTTAAGTTCTGCCATTGATGATTCTGTCTGCAAAATGTATGGTCTGTGGATTCAAGCCC
CTGTTTCAGGGAGAACCTCTTGATGAAGCAGATATAATGTGACATCAATTGACAGCTCTG
AGGCAATTTATAGCATTGTTCTGCTTACTGCCTTGTCATTTTAGTAGGTAGGATGTATTG
AGGTGACTTTTGATTTTGCAACTGTCTCTTTTACTTGATACCTTAACCGTTGTTTGCTTA
AGTTTTGACAATGATGATTCTGTCTGCAAAATAGATGCTCTGTGGATTCAAGCCCCTGTT
TCAGGGAGAACCTCTTGATGAAGCAGATATAATATGACATCAGTTGACAAATCTGAGACA
ATATTATGATATATTGCTGCTTGGTGTCTAGTGACTTTTATTATTCATGGTTTTCCAATG
ATGATTCTGTCTGCAAAATGGATGCCCTGTGGACTCAAGCCCCTTTTTCAGGGAGAACCT
CTTGAGAAAGCAGATGTAAAATGACATCAAATGACAAATCTGAGGTATTCTATATTGTGC
TTCCTAGTATTTGTAACATCAATTGACAAATGAGGTATTCCAGGACATTCAGCTTCCTGC
TGATGCAATAGGCTATGATGAGAAAAGTCATGCACCACTCTGAAGAGAATCATCTCTTTG
TGCTGATAAACAAACTTACAACCCATTTTACATCTGAGCCACCTCATGGATACCTCTTTT
TGTATTTTTTCTTTATTTGCTTTTCATGCCATAGATGGTACTTCCTCTGTCCGTAAATAC
TTGTCATAGGAATTAATGTATTAGATCCTTTTTTATTAATTTGTGCGACGAGTAATTCCG
GAGGGAGTAGTTTTTATAGTTTAGTTGGGGGAATGATGTACAGAACCAGATGACGAGGGT
TGCCCAAATGCAATCCTACCATGATGCGGACTGAAATTTCATTGAGGTCAAATACATTTG
CTGCTGATGGTTCTTCACAACCCCGCATATTTTGAATGCCATGCTTTTCTTGGTAAATTG
TTTTGTGAACCTTGTTGCATTGCATATGAATTACCTTGTTTTCTGTTGATAATTATGTCT
GCAGTGCGTGCTCTGTAGATGCAAAGGCTATGATGAGAAAAGTCATGCACCACTCTGAGG
AGATTTACCTCCTTGTGCTGATAAACAAACTTACAACCCATTTTACATCTGAGCCTCCTC
ACATTTTTGTATTTTCTGATTTATTTAGACGTATGTCAAATTGGTTTTTGAGAAACCAAA
TAGTTAAGGTAATAACTGGATTGGTGGGATAATATCGGAACCAGATGATGAGGGTCGCCT
ATTGGTGATCCTACCATGATGCGGACTGAATTAACATTGAGGTCAAGTACATTTGCCGCT
GATGGTTCTTTTTCCAATCCCCCCATATCTTGAATTGATTTTCTCCTTGGTTTTTGAATG
TTGTTGTTGGCTATGATGAGAAAAGTCATGCACCACTCTGAAGAGATTTATCTCTTTGTG
CTGATAAACAAACTTACAACCCATTTTACTTCTGAGCCGTCTCATGACTTTTGTATTTTT
CTGATCTGTTTATTGGTTTTTAGAAAATGTTTCCAGCTTTTGCCTTTGTCAGAATACTGT
GGTTTTGAAAGATAAGTCTTGCTGTTAACTGGATTGGACGAATAATGTAGAGAACCAGAT
GATGAGGGTTGCTCTAGCGATCCTACCATGATGCGGACTGAGTTACATTGATGTCAAAAC
ATTTGCCGCTGATGGTTCATCTTTAATGTTTTTTGTCATCCCTATTTTCAGTGTTTTGGA
AGGAGTGCCCTTGTATCTGAATTACTTAAGGTTTTGCCAATGATGTTTCTGTCTGCAAAA
TGGATGCTCGAGCCCCTGTTACAGGGAGAACCTCTTGAGATAATGACATCAATCGACAAG
CCTGAGGCATCCTAAAACAAGAAAACGCTTACACGCAAATCATGTACTTTCAGCTTTGCT
TAGATGTGGTTTCTCAAATGTATCTTCTTTCTCCTGATTGCAGAAAGACATTTCATGTGT
GAGGAGCTGCTGAACCTACCGGATTATATGAATCATGTGGTGCTCTTTTCTGGATGATGA
TTGTATCCATGTACCAATGATACAGAGGGAACATTGTACTGTGATTACATGTGTTTTTGT
AGGCTTGCCTGGTCAGGTCCCACACCTTTGGCAAGACTCCTTGTAATTCGAGAATTAATG
ACATGCACATATTTTAACTACATCCCATTTTTGCCTTAAATGTGGACATTTCATTTGTGT
CCTAACTTCAAAGTATATTCGGGGATGTCCACTTCTAATAGTTAAAATTTTGTACCTCAA
ACTTAGTTTTTTTTTTTTGTATGCATAATGGTAAAACTGTGTAATTTTGTTTTAGCGTTG
CACTCAGACAAATTAACTTTGTGATTAAATAACAAAACAGTTGAACCCAAAACTGCTGTC
TATTTTGAACTAAAATGCTGCCTATTTTTGTGATGACTTGCGAATCCAGTAGGTTTGTTT
ATGGTTTTGTGGGCTGGCGCGGGTGTGGATATAAATGGTTATGTTGGTTGGTGTGGATAT
AGATGGTTATGTGGGTGTGTTCAGGCGTGGCCGTGGCCGTGTTGACCCGCGAAACAGAAC
CCCCAAGCTGATAAATGAGTTCAAATTCAAACAATAAGATGTGCATAATGAAAGTGTAGT
TTTAAAAGACAAACGTAGAAATAGAACACCCNGAAACAGCCTTTGCTGCACAATAGGTTT
ACTATTGTTTGCTGCCAATGATGATTCTGTCTGCAAAATGTATGCTCTGTGGATTCAAGC
CCCTGTTTCAGGGAGAACCTCTTGATGAAGCAGATGTTATTTGACATTAATTGACAAATC
TGAGACATTGTTGAATATTGTTTCATGCTGCCTAGTTAATTTTAGTAGTACGATTGTATT
GATTTGATTTCTGGTTTAGAAACAGTCTTTTGCTGCATGATAGCTTGATTATTGTTTGCT
TAAGTTCTGCCATTGATGATTCTGTCTGCAAAATGTATGGTCTGTGGATTCAAGCCCCTG
TTTCAGGGAGAACCTCTTGATGAAGCAGATATAATGTGACATCAATTGACAGCTCTGAGG
CAATTTATAGCATTGTTCTGCTTACTGCCTTGTCATTTTAGTAGGTAGGATGTATTGAGG
TGACTTTTGATTTTGCAACTGTCTCTTTTACTTGATACCTTAACCGTTGTTTGCTTAAGT
TTTGACAATGATGATTCTGTCTGCAAAATAGATGCTCTGTGGATTCAAGCCCCTGTTTCA
GGGAGAACCTCTTGATGAAGCAGATATAATATGACATCAGTTGACAAATCTGAGACAATA
TTATGATATATTGCTGCTTGGTGTCTAGTGACTTTTATTATTCATGGTTTTCCAATGATG
ATTCTGTCTGCAAAATGGATGCCCTGTGGACTCAAGCCCCTTTTTCAGGGAGAACCTCTT
GAGAAAGCAGATGTAAAATGACATCAAATGACAAATCTGAGGTATTCTATATTGTGCTTC
CTAGTATTTGTAACATCAATTGACAAATGAGGTATTCCAGGACATTCAGCTTCCTGCTGA
TGCAATAGGCTATGATGAGAAAAGTCATGCACCACTCTGAAGAGAATCATCTCTTTGTGC
TGATAAACAAACTTACAACCCATTTTACATCTGAGCCACCTCATGGATACCTCTTTTTGT
ATTTTTTCTTTATTTGCTTTTCATGCCATAGATGGTACTTCCTCTGTCCGTAAATACTTG
TCATAGGAATTAATGTATTAGATCCTTTTTTATTAATTTGTGCGACGAGTAATTCCGGAG
GGAGTAGTTTTTATAGTTTAGTTGGGGGAATGATGTACAGAACCAGATGACGAGGGTTGC
CCAAATGCAATCCTACCATGATGCGGACTGAAATTTCATTGAGGTCAAATACATTTGCTG
CTGATGGTTCTTCACAACCCCGCATATTTTGAATGCCATGCTTTTCTTGGTAAATTGTTT
TGTGAACCTTGTTGCATTGCATATGAATTACCTTGTTTTCTGTTGATAATTATGTCTGCA
GTGCGTGCTCTGTAGATGCAAAGGCTATGATGAGAAAAGTCATGCACCACTCTGAGGAGA
TTTACCTCCTTGTGCTGATAAACAAACTTACAACCCATTTTACATCTGAGCCTCCTCACA
TTTTTGTATTTTCTGATTTATTTAGACGTATGTCAAATTGGTTTTTGAGAAACCAAATAG
TTAAGGTAATAACTGGATTGGTGGGATAATATCGGAACCAGATGATGAGGGTCGCCTATT
GGTGATCCTACCATGATGCGGACTGAATTAACATTGAGGTCAAGTACATTTGCCGCTGAT
GGTTCTTTTTCCAATCCCCCCATATCTTGAATTGATTTTCTCCTTGGTTTTTGAATGTTG
TTGTTGGCTATGATGAGAAAAGTCATGCACCACTCTGAAGAGATTTATCTCTTTGTGCTG
ATAAACAAACTTACAACCCATTTTACTTCTGAGCCGTCTCATGACTTTTGTATTTTTCTG
ATCTGTTTATTGGTTTTTAGAAAATGTTTCCAGCTTTTGCCTTTGTCAGAATACTGTGGT
TTTGAAAGATAAGTCTTGCTGTTAACTGGATTGGACGAATAATGTAGAGAACCAGATGAT
GAGGGTTGCTCTAGCGATCCTACCATGATGCGGACTGAGTTACATTGATGTCAAAACATT
TGCCGCTGATGGTTCATCTTTAATGTTTTTTGTCATCCCTATTTTCAGTGTTTTGGAAGG
AGTGCCCTTGTATCTGAATTACTTAAGGTTTTGCCAATGATGTTTCTGTCTGCAAAATGG
ATGCTCGAGCCCCTGTTACAGGGAGAACCTCTTGAGATAATGACATCAATCGACAAGCCT
GAGGCATCCTAAAACAAGAAAACGCTTACACGCAAATCATGTACTTTCAGCTTTGCTTAG
ATGTGGTTTCTCAAATGTATCTTCTTTCTCCTGATTGCAGAAAGACATTTCATGTGTGAG
GAGCTGCTGAACCTACCGGATTATATGAATCATGTGGTGCTCTTTTCTGGATGATGATTG
TATCCATGTACCAATGATACAGAGGGAACATTGTACTGTGATTACATGTGTTTTTGTAGG
CTTGCCTGGTCAGGTCCCACACCTTTGGCAAGACTCCTTGTAATTCGAGAATTAATGACA
TGCACATATTTTAACTACATCCCATTTTTGCCTTAAATGTGGACATTTCATTTGTGTCCT
AACTTCAAAGTATATTCGGGGATGTCCACTTCTAATAGTTAAAATTTTGTACCTCAAACT
TAGTTTTTTTTTTTTGTATGCATAATGGTAAAACTGTGTAATTTTGTTTTAGCGTTGCAC
TCAGACAAATTAACTTTGTGATTAAATAACAAAACAGTTGAACCCAAAACTGCTGTCTAT
TTTGAACTAAAATGCTGCCTATTTTTGTGATGACTTGCGAATCCAGTAGGTTTGTTTATG
GTTTTGTGGGCTGGCGCGGGTGTGGATATAAATGGTTATGTTGGTTGGTGTGGATATAGA
TGGTTATGTGGGTGTGTTCAGGCGTGGCCGTGGCCGTGTTGACCCGCGAAACAGAACCCC
CAAGCTGATAAATGAGTTCAAATTCAAACAATAAGATGTGCATAATGAAAGTGTAGTTTT
AAAAGACAAACGTAGAAATAGAACACCCATTTTGATAAATGAGTTTAAATTCAAACAATA
AAATGTGCATAATGAAATTGTAGTTTTAAAAGATAAACGTAAAAAGACTTCATGCATCTT
GGTCGCTCTTTCCTTGGCATCATTGAGGTCAATGCTGTCCCTGAATCCATTGCCTTCCTG
AATACATCGTTGTTGACAGTTGTTCCAACTGCGACAGCAAAATCATTGGTGATATTGGTT
TCGGTTCTTGTTGAGAAAACATCGTCATTGTAACATGCAAGCATCCTTCTTTGAGATGTC
TCTCTTTGTCATATCGTCAGTTTTTGTTGATGTCGTTCATTGCGGTTTCAAACCAGGATC
CTATTCTGTTTGGTAAGAAGGTTGGACATGACTTTGTTTTCAGCGGCACGTTTTCATCAA
AGAGCAATTTCCACCTCTCTTCTCATGCCTTCTTCTCGGCTAACTTTATCTTTGTCTTTC
AATACTTGGCTAGCATCACCTTATTGGGTTGCACCATGGCATTTATCTTGTCTTGCAAGC
TCAATTCTTTGTTTTATCTTTGTCTTTGAATACTTGGCTAGCATCACCTTATTGGGTTGC
ACCATGGCATTTATCTTGTTTGCAAGCTCAATTCTTTGTGTTTCCTTTTGATCTTCTCCT
TTATCGTCATCATCGGGCTTGTTCAAGTTTCGCCATCATCATCTTCATCTTCATCCATGT
TCGCAAGTGAACCTTTTCTTAGGTGCGGATTCTCTGTCAATCAACTTCCACTTGTCGTAG
TCTTTGAGCATTTCCCAACAATGCTCTTTTAATTTTTTTGCCTTCGAAAGCTTCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved