Hordeum_vulgare Locus poly:2:snoZ159
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:2:snoZ159
Hordeum_vulgare
poly:2:snoZ159
chr5H
snoZ159, snoZ159
1001..1083, 1455..1551
2550
ATTAACTAATCCTCATCCACGGTGACGAATAGCGCAACCCTATAGTGTAAAATGTACAT
AAAAAACAAATTTTCAGGTCTTGTGACCCATAATTTTGTTTTTATGTCAAATTTTATATT
GTGAATCAATATGAATTTAACGATTTGTATATCATATGTTATTTATGTATGGAACAATCG
TAAATTTACCTCGGATGAAGAATAATTTATTTTGTATCATGAAGGCTCAAACAATACAAC
AATTATTTCACCAATTTCTCTATTCCCTTCTACATAAATGACAATAGAAAAAAAATACGA
AATCCGCTCCACGGTAAAAATATGACCAATATTTAGCAAAATTATTTTTCCTTTATGTGG
TCATTTTCGTTTTACCGTGTTGGTATGTACTCCCTCCGTTCGTAAATGTAAGTCTTTTAA
GAGGTTTCACTAGAGAGACCATATATGGATGTATATAGACATACTTTAGAGTATAGATTC
ACTCATTTTGCTTTGTATATAGCCCTATAATGAAATTTCTAAAAAGACTTATATTTAGGA
ACGGAGGGAGTAATATGTGCTCATAGTTTTTCTTTTGAGGAGGGTATGTGTTCATAGTTA
ATTAGTTAACCAGTTCGGCCTGGGCTGGGCAAATTTGGGTGTTGGTAATTTTGTGGCCCA
TATCAGTACGTCCGTGGGCGGCAGGGCAGAGGACGAGACGGTGTGGCCAGGTTTCGCAAC
GGGAAACACCGTCCCCGCCGAGATCGAGATCGAGATCGGACGGTGCAGATTACGTTAGGA
GGTGAAAGCAATCGGTCCAACCCTAACCGGGAGCCTATAAATGCAAAAGAAATCCTCCTT
CCTAACCATCCACCAAACCCAGCCGCCACACGTGGCATCCCTCTTCCGCCCCCCATCCTT
CTCTCCTATGCATCTCTCCGCCTCTCCTCGATTTTTAGCGTCGATTTTCGCTGCAGATTC
GCATCGCTCTGCTTTTTTTTATTTTCTCTAGGCCCTGCTCGTTCTCCGATGATGACCCAA
ATAATACTTTCGTTCTTCTGAAATTCACAATGTGGAAGAACTGGAGACCTGAACTGAGGA
GACTGCATCCGGTTTTCTGTCCGTATTTCGTTTTCTTTCGCTCCTATCTGAGTTTGGTGT
TCGCGGATCCCTGTGATGACCTGTGATGTTAAAGTAGTGGCCTGATTCATACGTTGATGA
GATCCATATTATCACCCAGAGGGATCTGAACCAACAAGCAACCCGATCTTCTTGCTCGTT
TTTTTTCCCTATTTTTGCTATTCGATTCATTGATAACAAAAAAGTTTATTTGATGTTTTG
GCCTCCCGATGACTGGACAAATTTTAAGTTTCAGCCTTGTCTGAAAAATACAATCTGTTG
ATACATCTATGCAAATGTTTCTGAGGGACAATTTGTTTTCGATAAGTCTTTTCTTCGTTT
TACTTTGTGCTGAAGCTGTCCGATGATGATGAAACTAAATACTTTCGTTCTTCTGATGTG
CTATCTCATGGCGCGGTGCGGAAGCAATTTGGAGACCTGAACTGAGGAAATGCTTTCTTA
TAACGGGCGAGTTTGCTGTCTATTTCCTGTTTTTACCGCTTGCGTTTTGTGATTGAAAAA
CTGTTTTGTGTTTGTTGCTTCACAACTGGAAGGATGGCCTGTTGATAACAGTTCGGTCAT
CCCGTAGAGGGAAGCATAGATGGACGGAAACACGGCCAGCATTAAACAGCACTACGCTCA
TCAAACCGCGTTGTGTTACCTGTCTTCTGGCACATCCTAACACAAATGTTCAATTTTTCT
CCTTCTTGAGATTCGTGTGTCTACCTATCCCTTTTACCTTCTTTCATGCATTCCCTGGCC
TCTTTGTCGCCCACTCGCCGCTAGGACCCTGTGTGCCCCACATCCAGCTGCCAGCGTTGA
GGGGATGCTCATCGAGGAGGGAGAGATGTGGCGGCGCAGATTGAAGATTAGGTGGCGGCG
CTGGAGGGGACATCAGTTTAGTACTGAGGTCTCTTGATTCTATGACTTTGGACCATCCGC
CGCCGCCACCCACATCTTCTCTTTCCGCCTTCACGTCTCCCTTCTCGATTTCTGCCCCTA
GCAACCCATATCCCAGCCGTCTGAACTCAATCTTTCAGCAGTCTGATTTGGATCCAACGC
ATTGCATTCTTTTTGCCAGAACAAATTTAATGCAAATACGAGTTACAGATTGCGTCAAAC
CCTGTTGTGTTACTAAAATGTGCATTTTTTTTGCTTCGTAAATTTAGTGCACCTCATCTC
ACTTTTTCCCTTACTTTCCCTCTTCTCCTTGTTGACTGCTGCTCGCCTGCAAGTCCTGCT
GCCGGCGTTGAGGAGTTGCCCCTGCATATAGGGTTGCGGTGCAGGGGAAGGATCAGTGGT
GTTGCTGGATCGGACAGAAATCATAGATTTTTGTGTCCTTAATTTAAAGATTGTTGTCCC
AGTCTATTGCCACCACTTATCCATTCCTTTGTGCCGCTGCCCTTCTTTTCAATTGCAGCC
CTCATCCAAGCGTGTCTGATGGTATGAAATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved