Hordeum_vulgare Locus poly:2:snoZ103
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:2:snoZ103
Hordeum_vulgare
poly:2:snoZ103
chr6H
snoR31_Z110_Z27, SNORD14, snoU36a, snoZ223, snoZ159, snoZ103, snoZ103
1001..1098, 1513..1627, 3626..3711, 3764..3860, 4211..4302, 4619..4718, 4795..4893
5871
AACAACGGAGCCCTCCCCCCTATAAATTCTCCTACCCTTCATCTAGGGCTCCATCTCCA
ACCCGCCGCCGCCGCCAGAGCGCCCTCCGTTCACCTCGCCGACCGAAGCGCCTCCGCTCC
ACCGCCGCAGCAGCCATGGGTAAGCTCCCCATCTTGGCCCCCCTCGATCCCTACCTACTG
TCGTCGTGGTTGTCGGTCCTGACGCGGCGGTGCCTGGCTGCCTTCAGGTAAGGTGCACGG
ATCGCTGGCGCGTGCCGGGAAGGTGCGGGGCCAGACGCCCAAGGTGGCGAAGCAGGACAA
GAAGAAGCAGCCGCGCGGCCGCGCCCACAAGCGCATCCAGTACAACCGCCGCTTCGTCAC
CGCCGTCGTCGGCTTCGGCAAGAAGCGCGGCCCCAACTCGTCGGAGAAGTAGTAGATCCA
GCCGGTCTCGCGCCACCCCTCCTTTTTTGTTTGTTTGTTTGTTCACCAGTAGCTTTCGAT
CCGTTCGCGTATGCATGCTAAGAAGAAGACCTAATCAAGTGTCTGTAATTGACTGTTGTG
TTGGTAATGGAAATCTCACTGCTTTGTCCAGTTAATATGTTTTTACCTGCTTCTACTTGC
TATTATATCGTCTCTAGGCTACGATAGATGTGTGCTGCGGTTCTGATCGGAACGAATCCT
TTGCTGAACGGTGTAGCAATAGCGTGCCCGCCAGTTGTTTTGCTCTTGCTGCTGATGATT
TGTATCGATTTGAAATTATTTTTGAGCTTAATTTGGATTTGCTTCTTTTGCGGTTTATGC
TGATGGCAGTGACGATTTGCAAATATTCAAGCTCAACAGACCAAATCACAGGTCGTCTCT
TTTGGGATTGATTTGTATGCCGATTATCCCGCTGAACCGAGCCATCACTTTGAAGTTCCA
TGTTTTTCTTTTCAAAATAGTTGGATTTCTTTCAAAAAAATGGCAACTATTGGTCCTCTG
CCGGTTTGTGGCAACAACTCCTTTTTTTATTGATCTTTTCCAGTATCAGGTGATGAGACC
TTGAAACAATCTTAGGACACCTTCTGACACAGTGCTTTTATCCTGTGAATGAGAAGTAAT
TTATTTTCTGATGATACACAACTGGCCAACATTGTTCTCATTGCATATATTTATCCCTCT
CTAATTTTCTAGTTTTGTGCTATCTGTGGAGTACATCAATTGACACTTCCTGCAACTTTC
TGAGGTTTTTATTAGTTTAAAACATTTTTCTGTTGGCTGCGGTATCCCATTTTACTCTTG
GAAACCCCTTTTTTTTGCCGAGTGATTTTATGTTTGTCATTGTGGAGCAGCTGTTTGTAC
TGTAATCTAACTTGGGCCTAATGGTCCTTCTCTGGTAGTTACCAGCATTGACCAGGGGAT
CTATATTTGGGCCAACAATTACTTTTCACTCATTGATAGGAACCTGGAACTTGATTCTGT
TAGTCTGTGGATCCTATTATTGTGATTAAATGGCCAATATAATATAATTGAGTTGATATG
CTGCTTGAGTATAAGGTGATGATGATAAATTTAAGACTTGTTTCTCAAAACATTTGCAGT
TGCTGCCTAGGAGCTTTCGCCTTGCCAGGCGGAGCTGATGCAGCTAATTCCTTTGATGTC
TCAGCCTTTTTAATTTTCCAGCTCAATATAACTATGTATATCGAAAATGCTGCTGCATTG
CAAATGATTATAAAATCAAGATCCTTCGCCCTGCCAGGCTTGAGAGCTAGTGCCGTTTCA
TCCTTCCTTGGATGTCTTATGCAATGCTGCTAATATATTTCCTTTAGTTGTTTGGTGTTA
ATGCTAGCTAGGTGATGTTTGGTTTAAGGCTTGTTTCTCAACCAATCGCAGTTGCTGCCT
AGATCCCTCCTTGGTTGTCTGACGGGGTAATGTCGGATTTTGTTTTCTGTAGTAATGCAG
GTTTTGTGTTGTAGATTTGTTTATTTGTGTTTGTTTCTGTTTGGCCGGTGATGAAAAACC
AGTTAATCATACCATCTTTCGGGACTGATTGGTCGCTGTGCGCCCATGCTGTCTTTCTGC
AATTCTGAGGCCAAATTGAACTTCATCTTCTCTTCTTGAGTATGTAATTTTTCTGAATAC
TCTAGAACCTTTTTTTTCTTCTGTTGTTTACTATGTATAGAATTGGCTGGACAATGATGA
AAACCATGAACAAAACACACCATCTTTCGGGACTGATTAGCACACTCTGTGTGCCATGCT
GTGAAAATCTGCAATTCTGATGTCCCCATGGCATATTCTGTAAATTTAGAAAATGAATTT
CTGGTGGAATGTTAATTGCGCTTGAATTTTTCAAATGTTCTTCCCTTTATGTGGATCTTG
AGTTGCTTGCTGAGGTGTGGCAAATAACATTCTCCAAAAGTTGCTCCTGCTGTTCTTATC
ATAATTTTTTATGGCTTTTTTAGTTTGTTGTGTTCTCTGCAGTGCCGTTCTGTGAGTCCT
GTGATGGCACATCTTTGAGACCTGAGATTTCTTCCTTGATGAAAATCATAAGCATAATCC
CTGAGGGCTACTGATATTATGTTGTTCCTGGTCTTCCTGTTTGGTATTCTACTGTTTGTT
GATTTTCTTCCTTCACTTTTGCTCTTTTATTGTCTGATTCCATGGATGAAGCTATGCACT
GGGCTCTGAGCAGTATGATGGACATGCATTATAAAGCATTGTTTGATGGCTCAACTATTT
GTTATGGAACTCTTAACAAACTCTTACCTGAACTGAAGATTCTGTATATGTTTGGTGATT
GTTGTTTATGGATCCTGGTGATGTCTTGTGATGTTAAAAAGTAGTGGCCTGATTCATACA
TTGATGATATATATATATTATCACTCTGAGGGATCAGTTTAGACATTTTAAATTGGTTTT
TTGGCAGTCAATTGTTTTGGGCTCCTGATGGCTGGACAAATATGTTAATGTTTTTAATTG
CTTTGAGCTGTGTTGATATTTTTTTGGCCTTATATCTTTCTCTATGAAGAGAGTACAAGC
AGACGGGCGGTCTGAACTGATGTCGTGTTGATATGTCTGCATCATATGTTCTACCCTTGT
GGTTGGCATCTGAGAGAAAAATGTTAATCTTTTTCTTATTGGATGTGTCAATTTCTTAAA
ATTTCCGACTTTTTGTCATGTTTGCGCTTAGCTTCTTGTATCCCTCTTAGTTGCACTTTG
ATCTGAGGGATGGAGCTTGTGCGGATAGAGAAATGGTTTACTTACCAACCCTTTGCATTG
TTTGCCATTGCTCTTGGGTCAAATGGTCTAACCAAGATTTTCTTCTTTGATATTGTTCCC
AATTTTTTTGAACTATTTATATTTTTTGAGCTGGCAAGTGATGATCAGATATCCTACACT
CTCAAAGGAAAATTCTATGTGTGGACAAATATTCTCATCTTATTATCTGATGCCTTTGCA
CAAAATGCGCTTTTTCTTGTTTTGCCAGAAAAGATAATCAAATCCAGGGTTGCAAATGAT
GTTAAATATTATATGCTAAACACTGAATCTTTCTTATGTTTACAAAACTCCGCTTATTAT
CTGATGGCACCCATAAACTTGAAACGACTTTTATCTTGTCTTGTCTGCATGAATACCCAT
CCCTTATGTGGGTATCTTTGGTTTTGTGGCAGTGATTTGAATCTTACCCGCGCTTCTGAT
TAATTCATGAAGGACAAGGGAAAACATGGTTGAATTTCTTAATATGAGCCAAAAAGACCT
ATTTTCATTATTGTCATTCTTTTTTATTTATGTGTTCTGGTTTACCATGGCTGTGATGAT
AAACATTTTCAGTAAACATGCCAGTTCTGCTTTTGAAAAACCATGACTGAAAAACTTGTT
ATCGCATTTCTTAGCCTTTTTGTCTTCTTTTGGTTTTTTATGTGTTATTCATTAATTTAT
GAAGGACAAGGGAAACCATGGTTGAATTTATTAATATATATTTGAGCCAAAAGATCAATT
CTCATTATTGTCATTCTTTTCGTTTTATGTGTTCTGGTTTACCATGGCTGTGATGCCAGT
TATGCTTCTGAAAAATCATGACTGAAAAACCGGTTATACCATATCTGAGCCTTTGCATCT
TCTTTTGGATTTTTATGTGTTACTGTTTGACCATATCTGAGCTGTGGTCTGCATCTTTCG
TTATTCATGTGGTGTTTTTTGCTTGTAGTTTGCAATGAGAATGATTTGTACCTTTTTATC
TGGTGTTGAAGCTGTCTGATGATGATCGAACTAAATACTTTCGTTCTTCTGATGCGCTAA
GGTGCTATGCGGAAGCAATTTGGAGACCTGAACTGAGGATACATTTGATCATATTGTTCA
TTACATAAAACTAGATTTTTATTCTTGTGTTTGTTGCTTCACAACTGGAAGGATGCCTAT
TGTTGACAGTTTGGCCATCCTGTAGACGGAAGCATAGATGAGTGGAAACACAGGCCAGCA
TTAAACAGCACGACGCGTTACTTCACAGTGTCGTGTTACCTGTCTTCTGGCACATTTTGT
AACGTTGAAAAATGTGCATATTTCTCCGTATTGAATGTAGGTAATATGTTGATTGATTGT
GGTCCTGTGATGACCAAACTGAACAAATTTGTGTTGTCAGAGGTTGCTTTCTCGTTTATG
TGGAAGTGAGGATCCTTTCCCCAAATGATCGACTATGATTATACTGTGCGCAAATGAAAT
CCTTTATCAGAGGATTCCAAGCCAGAAATCTGATCCATAGTGCCCAGCAATCTCTATCCC
CTCTCTTCTTTGTCTGCTGTCCTGTTTGTTTTCTTGCTCTTGATTTGTAAGTTGAATGGA
AGTGAGGATCCTTTCCCCATATGATAGACTATGATTATACTGTGCACACATGTAATCCTT
ATCAGTGGGTTCCAAGCCAGAAATCTGATGCATTGATTTGTGCTTCCTTTGTTCTCTTTG
AGCATTTTCTTTTTTGTGTTTTTCATTTAGTTATAAATCTTTTTTATTCAAGTGTTCATG
GCAGTTTTTATTTTGAAAATTGTGTTGTAGACAGTTCTGAGTTGATCTTACATGGTTGAA
ACGTATAAGTTTTGTGGCAAGTGGGCGCCTTCTTTTGCAAATAGATGGTTACACCCTCTG
GGGTTGTTAGACGTTGCTTGCCATAATGTACTTTGGCACTGTACCAGGTGACTAGCGCAG
CCTCGCAGAGGTTGTTACCATATATTCAAATGAAAAGCAATATATCATAATTGAACATTT
GGGCTTAACATGACCAATAATTGGTATGTCAAATTCCAAAGTGTTATTTTTGAATTGATG
TTTGGGAATTACGGGTAGTGTGCAGATCAGATTGTCTACCTTTACGTTTGAGCCTATATT
ATTTTGGCTTTATAATTTCCAAAGTGCTCTCTCAAATTATCATGATATTATACTAGGGAA
AATCTAACGAGAGGCTGCACGGGCATCGTCCCGTGAGGCGGTTGTTTTGAGACCTGAATG
CTCCCACTGGACAAATTGCGTAGTGATGGACCTGCAGGTGGACGGTTGATACCCTTTTTT
TTTTTTTTTTTTTGAGAAGGAGCTGGGTTTGCTTCATTTGCATTTACCCATCACGCGAAG
CTTGCTCCTCGTCAGAGACCGTACTACTATTGGCACCTCCCCTCTTTTATGCTTGTTTCT
ATCCGTATTTAAGGATTTTGTAACACCTTTCAGAGCAGTAAATGAATTTTGCAGATTATT
TGCAAGATGTTGCAAATTAGTGGTCTTCCGAACTTGAAGTTCGGTCTCATGGGAACGTGT
ATCAGAGGATGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved