Hordeum_vulgare Locus poly:2:snoZ103
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:2:snoZ103
Hordeum_vulgare
poly:2:snoZ103
chr4H
snoZ103, snoZ103, snoZ103, snoZ103, snoZ103
1001..1100, 1199..1294, 1344..1439, 1497..1592, 1657..1757
2756
CTTCTGATTCATCAACCTTTATGCCCTTAGACTGCACAAGTGCACTAGCCAGCCTGTTG
GCTACGTCGTATCTCTCCCCTCCGGGAGACCTGGGTTTGACCCTAGGTACTCCCTATTTT
TTCTAGCCTTTTGAGACTCAAACCCAAATATTTTACAGATTAACGTATTTAAAAAAATAT
TCATATCTTTCAAACCTCAATTTCAAATTTAACGTGTTATGTGGTAAAAAATATTTATGA
TTTTAAATATGTTCATGATTTTTTAGAAAATGTTATGATTTCTAAATTGTTCATGATTTC
ATGAAATTAAGAGTGACAGTGTATCTCAGTGATGCAGTAAAATATGGTCATCTTCATTGG
AAAATACGGAAAAAAATCCGTTGCAACGCACAGGTCTTTTGCTAGTAACTAATGATTCAC
TGATCAACGCTGAACCGTGCACATAATGCAAGCCTTCAAATAAACACGAACATGGAAAGT
CAAGCTGACATAGAGATGAGAAAATTAGCTTATTTTGCTTTCAGACAAGATGGGAAAATT
AGCCATTTTGATTTTCGAGATAACTATGGGAAGTTTTTTTTTTTTTTTAGCATCCATGGG
AAAACCAACTAATATAGGCCCAGATGCGCGGTATATGATGGGCCAGGTTACAGGAAGGCC
CGAGAACATCTCCCACCGCCGTCGCTAGTCCAACTCGCAGACGTGTCTGTTCTTCATCCG
TTAGATGCGTGCTAGGGTTTACGACCCCCTATATATAACGCAGTCCTCCAGCCGCCAATA
GGCGTTCGTCGTCTTCCCCGGCCGCAGGCTTCTCGTCTTCTATTTTTGCCTCGCGTCGAG
TTTATAGATATTTCGATCGGAAAAACATCTTCTTGGCAATTCGATTCCGTTCCCCGCTTC
ACGCCCGTCGGATCTGCAACTTTCGTTTTATTGTTTGATTTGATTTGATCTTGCTGCTTT
GTTCTTGAAGTTTCTCGGCTGAGATTTCGTTGTCGATTTAGATGGATGTGAGGATCCTTT
CCCCAGCTGATCGACTATGATTATACTGTGCGCAAATGCAATCCTTTATCAGAGGATTCC
AAGCCAGAAATCTGATCCATCTCATCGAACTGTCTCTGCCTCTGCTCTCGTTTTTGTATT
CCCGTTCTGATTTGTTTTCCGTGATTTTTTTACGGTGGTTTGTGGTGAAAATTAATTGAA
TGGAAGTGAGGATCCTTTCCCCAAATGATCGACTATGATTATACTGTGCGCAACTGTAAT
CCCATCGGGATTCCAAGCCAGAAATCTGATCCATTTTTTTTAATCTTCCCTTGTCGACTT
TGTTTTTCATTATAAAAAGGCATAATGGATATGAGGATCCTTTCCCCAAATGATCGACCA
TGATTATACTATGCGCAACTGTAATCCCATCGGGATTCAAAGCCAGAAATCTGATCCATT
TTTTTGGTTTCTTTAATCTTCACTTGTCAACTTTGTTTTTCATTTTAAAAAGGCATAATG
GATATGAGGATCCTTTCCCCAAATGATCGACCATGGTTATACTATGCGCAACTGTAATCC
CATCAGGATTCCAAGCCAGAAATCTGATCCATCCGCTTATGAATCATCTTTTTTTCTCTA
TGGTACTTGGTCTATTAGTTTTGTAGCTATGTTTCGAATGGACGTGAGGATCCTTTCCCC
AAATGATCGACTATGGTTATTACTGTGCGCAAATGTAATCCTTTATCAAAGAATTCCAAG
CCAGAAATCTGATCCATTTATAATTTTGCTTCTTGCTAATCACTTCTATTTGGTTCTTTG
GGATTGCTGATGTTATGTTCACCACCAGAATATTGCAAAAGAAATATTCGTGATGAATGT
TTTAAAGTTTTATATCAAGCGACAGCGTATCGTGGATGAACTGATCTCTCTGTAAAGATA
TTGTTGTAGATTATTTAATTTTGTATTTTTTATGTATGATATTTTTCAATTCAAAGTGGT
CTATTGAATTAGAAAGACTTGTTGTCAGGTTCAGCATAGAAATTATGCGCATAGTGATTC
TGACCTCTAATTTATGCGTGTCAATGCTTGTTTGGTCGAGGTGTACAAATCTAAGAATTG
GTATATGTTGTCTTTTGGCAGTGGTTGCATTTGTCACCATGAGCCCCAAAACAACTTATT
TTGTTTCGTCCATATTGATCTGTTTTTTCTGTTTTCATTGTTCTTTCTTGTTTAGTTGTC
AATTTAATTATGGATTGGAATCTATGGAAACAGGTGAACAATAAGATGACATCAGAGATC
GACCAAGTCTAATGAGAATCTCTTTGATCTTTTCTTTGAACCAAGCTAATTCGAATGTTA
GCTATTTTCTATTGTCTGCTTTGATTGGCTTCCAATGATGCATAAAAATGTGTGTTATCG
GATTGTTTCATGACGATCAAACACATTGTCACTACCACTGAGGCAGCTTTTCTTAGCTAA
CAATATTTATGGAAGTTTTATTTGCTTGAGCTTTGTTTAGTAAGTGGATTGGAGCAAACT
GCCCGTGATGGTGTTAAATATACTTTGCAGCTTATTGCTATGAAAATTACCTACAGTCTG
AGGCACTTCAAATCCACTGTTGCCAGCGAACGTTTAGCACACAGATCTTCATTTCTCTAA
AAACAAATATCTACAAGAAGTTCCTGATATGATTTATTAACACAGGACATGTATTGATAT
TGGCGCCATACACTGACCTTGCAATTAATGGATAGGAAGACTGGTTGAATTCATTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved