Hordeum_vulgare Locus poly:2:snoU31b
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:2:snoU31b
Hordeum_vulgare
poly:2:snoU31b
chr7H
snoU31b, SNORD14
1001..1091, 1413..1537
2573
TCCGATTTTGTGTCGCCGCCGTCGCCTCCACTTCGACCTCTCCGGTCCCGCCGTCGCCG
TCCGCCTCGACCTCTCCGGTCCCGCCGTCGCCGTCCACCTCGACCTCTCCGTCGCCGCCG
TCGCCTCCACTGACTCCCGCGACTCCCGCCGTCGTCGTCCGCCTCGACCTCTCCGGTGCC
GCCGCCCGACGTCCGCCTCCACGCCGCCGCCGCCGTGCTCGACCTCCGCCGCCGCCGTAC
ACCGGTAAGCTCTGCCACTGACCTAGGGCCGGCCCTTGTTGAGGTCTACCTCTCCTTCCT
TCTCCTCGTCGCCGTTGCACTGCTGCCATGTCTTTCTCCTTATCTGATTGTAGTTGAGAA
CAAATTGAGAACAAATTGTTATACCTTCTGTAAGAGTGTTTGTTTGTTGGTGGCCAAGGA
TTAAAGTAAATTAATAGACAAGCATATGTCTGAATTTTCTTCATGTGGAACGATCTAATC
TTCTCTATGAGGCCAATGATCTTGCTCATTTATTTATCTGTAGTTATATTTGATTCGTTT
TATTTCTTCATGGTGCTGATGATGATTAGTGTGAACCTTTCTCAATGAAATCACAAATGA
TTACATAACCTACTGCCTTCCTTCTGAGGCATCATGATTCCTGGTATTCTATTTCTGTTT
TTTTTGTCTTTTGTTTTTATTTCCATTGAATTGTTGTGTGCTCCAGGTCAAGTGATGATT
ACAAGTGCATAGTTCATATTGAATTGTTGTGTCCATTGAATTGTTGTGTGCTCCTGGTAT
TCTATTTCTGTTTTCTTATTTGTCCTTTGTTTGAACTAAACTAATTAAATCATTTTCTAT
TAGACTAATAAATATGCTCTTTTTTATTTGCTTTGATGTGAGCAGTGATGAGACAATTAA
ATAAATATGATCTTCCAGGTGTGATTATCAATCGCTACGTTCTTGCTGAGCTCCTATCCT
GTTGTTTTTGTTAATTCAGTTTGGTTTCCACGGGAAACTTTTATTGTGATGGTTGACATG
ATTTTTCCAATCCTTTTTGAGGATGATGATTTCATATTTGTCGCCCCAGTCTTAGGGTCT
GCAATGTTGTTGGATCTGTGCTGATTGACATACTTCTGAATCTGACTCTGTAGTAGATGA
TTTCATAGTTTGCTGCACCCTTATACCCTCCCATACAATTGCAGATTTGTTTAATTCTTG
TCTTCCAGTTGGTTCTGTTTTCAATATATACTTGATTTTTCCTTTGGTGATGGCAGTGAC
GATTTGCAAATATTCAAGCTCAACAGACCAAATTACAGGTTTTCTCTCAGGAGTTGATTT
GTATGCCGATTATCCCGCTGAACCGAGCCGTCACCAAAGGAAAAGTCAATTGACGAAATT
GATTTTGTTTGCAATTCATTATTCTTCTCTTTTTGTGTTTGTTTTTGTTTTCTGTTTTTT
GGTGATGTAGTTGCGATGATGATAACAAGCTCCCTCTTCTGAAAGCATTGATATTTCCGG
AGCCGCCTAAGAGCTTTCGCCCTGCCAGGCTAGAGAGCTAATGCTGCTAATTCCTTCCTT
GGATGTCTGAGCCTAGTTCACATCTCCCCATTTCGTATTTGTATCAATTTTAGTTTCTTT
TTTTTTGCTGCTTGTTTTTCAAACATTTTGCTTTCTTTGTTTTTTGCCCAGCCAAGTTTT
ATTCTCTGAAGCTGATTTTATATGCTAATTAAGTGATTTGAAGGCTGTTTTGAAATGTAG
ATGATAGTTTTTCAATTACCTTTAACAATGTTCTCTTCTTGAAATATATTCAATAAAAAC
ATTTCATACATTGTCATCATCAGTACCACGTGACGAATTCTACATTGACTCTTATTTTAC
ATGATGTATTTACATGATATATCTAATAAATCTTAACCATTAAATTTTAAATCTAATGGC
TGAATTAATCTTGATGATGCCATGTAGAGGAGTCAAACGTGATTTCAATTGGTAGAATAT
TCCGTAAACTTTTCCGTAAACTTTCCGGTTCCGTAAAACTTTTCCGTAAATAATTTTGCT
AAGTTAAATTCTTGTTACTAGCAGGTGTTGAGCTATGGATCCCCAAGAACCACATGATCA
GCACGCCGATCAGCTCGCGGGAATGGGTGAGGCGGAGAAGGAAAGATACATGTGCCAGAT
GATTTTTGAAGATGCAACGGCCATATATCATGATGACGACGGTGGAGAGGCGTTTAGCAA
TCAATTTTTGAACGACTCCGGTGACGGAGCTGAGAATATAGAACATGTAGTAGATGCAGA
AGTGCCCTCCGGAACAAACTCTGCCAATGTATATCTCAAGTCACTGTTGACGCAACAATT
AATTTGTATTGCACTTACTAACGAATCTTTATTTTTCCGTTTAGGCGCCCTCCGGAACAG
CTAGCGCAAGTACTGAGACAAAGTCGAAACGAGGCCCGGCCGCAAGGTTGAAAGATACTG
CAAGGTACTCGATCGATAAAGTTGCTGCTGATGGCAAACCACTGGAACCCCCAGAAACTT
ATCGCAAATTTATAAATCAGTGCGGAGTTGTTGTAAGAGACCTGGTCCCGATCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved