Hordeum_vulgare Locus poly:1:snoU31b
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:1:snoU31b
Hordeum_vulgare
poly:1:snoU31b
chr1H
snoZ43, snoU31b
1001..1097, 1977..2064
3063
AAAATACTTTTCTGCCGCCGCAAGCTTCCGTTTCCACGAGATCTCATCTGGAGACCCTT
CCCGGCGCCCTGCCGGAGGGGCCTTTGGAGTTGGAGGGCTTCTTCATCATCATCATCGCC
CCTCCAATGACTCGTGAGTAGTTCACTTCAGACCTACGGGTCCGTAGTTAGTAGCTAGAT
GGCTTCTTCTCTCTCTTGGATCTTCAATACAAAGTTCTCCATGATCTTCATGGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGGTGATGACGATGGCGATGATTTCC
CCCTCCGGGAGGGAAGTTTCCCCGGTAGGATCGTCCTGCCGGAGCTCTAGATTGGTTCTG
CTCAAGTTCCGCCTCGTGGCGGCGGCGGCTCCTCCCGACAGCTCCCTTATGGTTTTTTCT
GGGAAGAAACCCTCCATATAACAAAATATGAGCGCCAGAGGGGCAACAGGGGCCCACAAG
CCACCCAGGCCCGGCCAGACGGGTAGGTCGGGCCTGGCAGGCTTGTGGCCTCCTGGTGGC
GCCCCTATGGTCCTTATTCCTCCCAGTATTTTTCATAAAATCCAAAATAATTCCCCGTTG
ATTTTCACGGCTTTTGGAGTTGCACAGAATGGGTATCTCAAACTTGCTCCCTTTTCAGAC
CAGAATTCCAGCTGTCGGCATTCTCCCTCTTCATGTAAACCTTATAAAATAAGAGAGAAA
AGGCATAAGTATTGTACCGTGAAGTGTAATAACAGCCCATAAGGGGATAAATATCAACAT
AAAAGCATGATGCAAAATGGACATATCAACTCCCCCAAGCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCATGTCTGAATTTGTTGTAGAGGACGGTGAAGATTGATAT
TTGGTCTCGTTCGTCGTAACTGGCGTTTACTTGCCTTGCCGACCATCCTGCTATATCACC
ACCCATATTCTGAGTCCTTAATTATTCAGTTTTAGTTTTGTTGTTTGGCCTACTATTAAT
ATAAACTAGTGGGCAAGCATAAGTCTCGATTCTCTCTTCCATGTGGAAAGCATAGTTAGC
AATGCGGTCAAAATCTGATTGCTTTTGTACTATATAACCATATAACTTGTCTGACGTAGG
CTGATCATGACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTA
AGGCTATTTAGATTTATGAATGGTTTAGGAGAATTGTATTATTTACTTGAATTTGGAGCA
GTGACGAGACAATTCGCTTATGATCTCTGAGGTGTGATTATAGTTGCTACGTTCTTACTG
AGCTCTGTTTCATATGTTCAGAACTGTAATGATAATTCCACTGAACACTAGAAAGCCATT
CTATTACACATTACATGTAACCTGTCACATAGTACTAGTTTCATAATAGAGAAATGACAG
AATTAAGAATAATACATCTTTTTTTTATGCGGCACTAGTGTAGTTGAACTATTTTTGAAT
TGGTAGACTATGTACAAAAGTTACTTTGATGTTTGCAATGATTCTCCAAACCAGTTTGAG
GATGATGATTTCATATTTGTCGCCCCAGTCTTAGGATCCGCCTAGGTGGATCTGTGCTGA
TTGACATACTTCTGAATCTGACTCGGCAGACGAAAATTTTGAACAGTTGGTTCGATTTTC
TTTTCTACTTATTTTTCTTGGCTGGTGGTAGTGACGATTTGCAAAATTCAAACACAACAG
ACAAAATCACAGGTTTTCTCTCAGGAGTTCATTTGTATGCTGACGTGTTTGTTTGAATTT
TGATTGGCAGTGACGATGGCAGTGACGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNAAGTTAGTCCCAAAAAGATATAAAAAGATACATAAAACATACAAAGAAGG
CAAGATAACAGCGTGAAACCATAAAAAATTATAGATACGTTTGAGACGTATCAAACATCC
CCAAGCTTAACTCCTGCTCGTCCTCGAGTAGGGAAGTGATAAGAATGAATTTTTGATGCT
TTCATGCTACCTAGCATAGGTGTCCTTTGTTATTCCTCTTATGTGACGTGAATGTTCAGA
TCCATTAGATTCAAAACAATAGTTTGCTATTGACGTGGAAACAATAATAATTGAAGCAAA
CTAGCAAAGTAATCATGAAATTTCAAAATAACAAGGCCAAAAGAAAGTTATCCCTACAAA
AGCATATAGTCTGGCCATGCTCTATCATCATTGCACAACGAATTTAAATCATGCACAACC
CCGGTATTGGCCAAGTAATTGTTTCACACCTTTACTTTCTCAAACATTTTCAACTCTCAC
GCAATACATGAGTGTGAGCCATGGTTATAGCACTATAGATGGTGTGGAATGTGGTGGGGG
TTGCAAGACAAAAGGAGAAGATAGTCACATTAACTAGGCATATCAATGAGCTGTGGAGTT
GCTCATCAATAGATATCAATGTGAATGAGTAGGGATTGCCATAAAAATGATGCACTAGAG
CTACAAGTATGTGAAAGCTCTTAAACAAAATTAGTGGGTGTGCATCCAACTTGCTTGCTC
ACGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved