Hordeum_vulgare Locus poly:2:snoR11
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:2:snoR11
Hordeum_vulgare
poly:2:snoR11
chr4H
snoR11, SNORD14, snoZ101, snoZ101, SNORD14
1001..1101, 1628..1749, 3365..3462, 3671..3764, 6388..6509
7508
AAGTTCCTGTTTGATTCTCCCCAAGTCCAGTCTCGATTCTGATTTTGTGCTAACCGATC
CGTGGCTCGATGATGACTACTTTGCTTTAACCACACCGAATCCAAGGCCGGAGGAAGTGT
GCTTCTCCGCGCTGCGTCGTTGTGCTGCCCTCTCTCGTTGGTTCCTCGCGAAGTCTCTTC
CTCTCGTCGAAGAATCGATTTTCTTCTTTCATGAGAGGTCTTGACGGAAGGATTCGGCGA
GATGGGAGAGCATAGCTGGTGGTACCGGCATGGCCGCTTTCGATGGTCCTTCACATGTGG
AAAAACAGTGCCTTTAACTGAGAGCCTAAATAGATCTGGTTTCTTTTGAACCGCAGTTAT
GCAAGATTTTTCGAGTACAATGTTTATCTGATTTTCTTAGGTTTAACTAAGCCACTTAGG
TAGCGAATGATATCGGCTTTCTTGCAATAGAGTGCAAAATAACACATTAAAGAACTAGAA
CTAAAATTGCAACCAAATAGTTTTCTGTTGAGTAGCAACTGCTGATAATCTAAATCTTTG
ATATATTTCTTCCCCCCTTTGCAATTAGAGCGAACTAATCCAGTCCAACCCCTGTTGAAA
AACTGGAAATTGTTTTGTGTTTAACTGTAGATTTGACCTTGAAGCAGCGATCTCTACTTT
GGTAGACAATTGAATGACCCATTTTGCAAAGGAAAATCATGACAGTATAGTTATAAAATT
CATAGCTAACACATGGATATATGCAATTCAATGACTATACAAAACACATAAAAGACCATT
TAATTAAATATATTTGAGAATTTTTTGATGTGAAATAAAAGCAAACTCATTTGGTCCCAT
AGCTTTTCCTTTTGAGGCAATTTCTTTGGTTCTGAGATGGATATAACCCAAATATCTTGT
CTGTGAGGGAGGTTATCTTGTTATCTCGTGGAGGTGTTTGGATGTCATTTCCTTAATCTG
GTGTTATCTCTTACATTTGTGTAAAGTGAATTTGATTTGGTTGGCTGCTGATGATTCAGG
TCATAAAGGATCTTAGTGGATTTCGGTGAGGTGGATTTGTCTGCCGTTGATCGATTCATG
TTGTTACACACACTGAAGCCTTCTCCTTCCAGTCTCTTCTGCCCATTTCATTCTTGTTCC
CAGTGTCCCTTGTAGGTTTTTGGCAGCTTCTTGTCATCCGTGAGCCTTCAAAAAAAAAGC
TGACTTCTCTTTCCACTGAGCAATTCTTAATTTTGTGTTCTTCTTTGCTGTAGCACAGTG
TAAACAGCAGCTGCATCTTTGCTGCTGCAACTGTCTATCCCTGTATCATAACCTTTGTGG
TTTGTACTGGGTGGAAATACCCATTTGCGGCTGCTTTATTCAGCTATGTGTGTTTTGAAT
TGGGTCTCCGAGGGATTGCTGAAATCTTTTCTGTTCTCTTGTAGCATTTTATTCTGTCTT
CTTGGGCCTGATGCCACGTCTCTGGTAGCCAAAGCCTTTACAGGAGATGCTACATTTTGC
TTACAGATATTTTCACATTTGATAGGTACCTGTGGCTGTGATTTAGTCGATGCACAAAAC
TGTTTTTTTGCGATTACATTTCTTGCTTGACATAAGTATTTGTTTTGATTTTAAATTGAG
GAAAACAATGGTGATGATGATTGAACTAAAGTTTGTTTCTCAAAACATTTGCAGATATTG
CCTAAGAGCTTTCGCCCTGCTAGGCTTTAGAGCTAATGCTGCCAATTCCTTCCTTGGGTT
CCTGTGTATCTTTCTCCTTATTATAGGACAATTCATAAATTGATGCAGATAAGAAATAAA
TAAAATTCCCAGGCCATCATTGCGAGAATGAGAGATGTGCACAAAGCTGTGTCATTATAT
TGAATTGTAGAACCATCATTTCCCTGTCTATGCATCTGTCTTACTCCTAAAAATTAGGTC
TCTTCACCCTAGGCTATGTTACTACCTTCTTATGTGTGTTGTTATGCAAAGCTTCATTTA
TTAGTTTATAAACTCATATTGTATTGGGATATGTTATGTTACAGTAACTAGCTGAGTTAC
TCAAATTACCTCTCTCCTAACTAACTCATTACCACATAGGCAATTTTACTGAGTTGGACT
TTATGTTACCGTTGAAGTTATTCCCACTATGGCCAGTCTAAGTTGAATTGTCATCCACAA
CGAAATAACAATGGAATGAAACATTACAAACTACTCCCTCTGTTCCTAAATATAAGTCTT
TTTAGAGATTTTACTAAGAGACTACATACGGAGCAAAATGAATGAATCTATCCTCTAAAA
TGTGTCTATACATCCGTATGTAGTCTTCTAGTGAAACCTAAAATTGGAGGTAGTATATTT
AGGAACAGACGGAGTATTAAACAAATGGAAGTCACATAGCTCACCATGAAATAAATAAAA
AACACGAAAATTGCACCAAATCCATTGGAAGGGAGAGTATATACAACTTTTGGTTTCCAT
GTATTCTCAATCAAATCATTTTGAATTTGACTTAGTTGTCTAATCATGCGATTCTTGAAT
AAATTTGATGAAATGTTCATATGTTTTTGCCTAAGTCTCATCCTGCCAATCTCACCTTTG
GTCATAGATATCTATGACTATGCTGTGCAAGGTCACTCATCGAGATTGGAAAACACCAAA
AGTGTGCTCTGCATCCTTTCTATCACTTCTGTCGATGAAGGGTCCTGTTCACACCAGGGC
TGTCAAACCATGCGTCCTCTGGTTGTGACTGTGGAAGTAGTGGTGGTATGATCAGGGCTA
CCAGTGACTGTGGGTAGGCTACCATTGTTCTATTTTGGCGGCAAGAAGCGGCCACAATGC
CAGCAGAGTGGGCATTCGTGGATGAGATGGTGGTGGGGCCATCGGTGGATGTGGTGGTTG
GGTAGTGGCAATTGAGAAGAGGCCTGAAGCTGTATGGTGGTGGTCGTGACGGCAAACAAG
TTGGGTTGTTGATGAGGGGAGGGATTTGAATGGCCTATGTGCCACTGAGAGACAGGCCTG
TGGGGAGGACAAAGGTTGGATACTGCGGGTGTCTGGTGTGTCTGAGTGGACCCAAAACCA
GACCAAATTTGGGCGTAAATGGGTTATTTTGGTTATCAATTTGCTACTGCTCCAGACCAA
ATCTGTCCTTGTGCATTGCAAAAACTGATTACCGATGGATCTCATTGCAGCTGTTGAGAT
GGTGCCTACAAATGGGGATTCCAGCCAAGACCAATTCCAACTTAACAGTGCTAGCCCGCC
TATTTTGCTAGTGTATCTCCAAAAACATCGCGTGCTTATTTACCAACTATTTTGCTGGTT
GGGCTGTGTTGATTTATTTTCTGGTTATCATTCTCTTCTGCTGGCTGTTTCTTGGAGGAG
CGTCGTTGATGCAGATGAGGAGACACAAGTTTATGGGTAATTTGCGTCTGAGGCATCTCT
GTGATGTCCCACCCTTTTCACCTTGGAGATCTGATGCATCCTTGAGAATTATCTTTCTAT
GTGTTTTTTGTCCTTGCCACTTTTGATTCGTTTGGGTGAGATGAGGATATAGTTCCATTG
TTGATGGATGATATGATGTCCAGTGAATCATGTATTAGCTCTATCTGATCATACCCGGCA
CTGGGTTTGTCTGAGTTTCTCTTTTTTATTTGTTGGTCTGTTTCTTTTTAGTTGTTGAAA
ATGAGTGCTGTTGGATGCAGATGAGCAGACATGAGTTTATGTGTAATTTGTGTCAGCCAT
TTTTGTTATGTCACTCTTTTCACCTTGGAGGTCTGATGCACCCCCCTCACTCACGTCTTT
CATGTTCTTACTACTTCCCTTTCAAAAATCTGTTGTTTTGGGTTTTAATTGGTGAGAGAT
GAGATGATGAATGAGATTAATTTCCCTATTGGTTTGACTGGCTGACATGATGGCCCACAC
GCTGGACTTCGAGCACCTCATCCAGCTAGTTGACCTGTCAGGTCTAGAGGCGCCGTTCAG
CCCCGACGAGATATGGTAGGCTGTGCGGCGCATGCCGGCGCACAAGGCACCGGGGCTGGA
CGGCTTTACCGCGGAGTTCCTGCGAGCGTGCTGGAGCACCATTAAGCAGGACGTGCTTGA
GGTCTTTGAGCAGCTCTATACGCCGAGGGGGCGTGGATTCCACACGCTCAACAAAGCACT
GCTCACCTTGCTGCCAAAGCGCTCCGATGCTCACAAGCTCGGCGATTACCGACCGATTTG
CCTGATACATATTGTGGCTAAGCTCTTCGCGAAGGTCCTTTCCCTGCGCTTGGCACCGAT
GCTCGACGGCCTAGTGAGTCGCTATCAGAATGCTTTCATCGTCGGACACTCCCTCAAGCT
CCTGCACCAATTGTGCGCGTCGAGGATCATGCTCAAGCTTGACCTCACCCGGGCCTTCGA
CTCCATACCATGGCCCTTCCTCTTCGAGGCCCTGCGCCAATATGGCTTCGGAGTGAGGTT
CCGGGAGTGGCTGGCCATCCTCCTCTCCTCGGCCAGCACCCGCGTCTTGCTCAATGGCGT
GCCGGGACCCTCAATCTGGCACCGCCGTGGGTTGAGACAGGGTGACTCCACATCCCCGTA
GCTCTTCGTCCTTGCCGTCGACACGCTCAGCCGCCTCATGCAACGGGCGTTCCAGGCCGA
CATTCTTCGGAGACTCCACCCCCGACGCAACATCCCGGCTATCTCGCTTTACGCCGATGA
TGTGATGCTGTTCTGTCACGCCTTGACGGACGAGGTCCTTGCTGTCAAGGGCATCTTAGG
GATCTTCGACTCCGCCTTCGGCCTGCATGTGAACTACGGCAAGAGCTCTGCCACAACACT
TCATGGAGATGAGTCGACCGTTGAATCACTGGCGATTCTGGGCTGCCAGACGGCGGCTCT
GCCCATCACGTATCTGGGTATCCCCCTCTCCACGCGTCGCCCCTCCGCGGCTCAGATGCA
GCCTCTAGTCGACAAGGTGGCCGGCCGCCTCCCATCGTGGAAGGCATGGCTCATGAACAA
GGCCGGGCGGCTGGCGCTCGTCAAGTCTGTGCTCAGCGCCATCCTCGTCCACCAAATGCT
CGCCCTAGCGTCCTCAAAGAAAACTCTGAAGCAGCTTGAGAAGATTCAACGTGGGTTCCT
CTGGGCCGGGCGCGAGGCTGCCCACGGTGGGCACTGCCACGTGAACTGGCGCCGGGTATG
CCGACAGTTGGAGTACGACGGCCTGGGTGTCCGCGACCTAGAGCGCACGGGGCTTGCCCT
TCGGCTCCGATGGCTGTGGCTCTCATGGACGGACACTAGCCACGCATGGCATGGCCTGGA
CCTGCAGTTCACCCCCGAGGAGTATGGCCTCTTCTATGCCTTCACCACCATGCAGATTGA
AGACGGATCGACAACGCTCTTCTGGGAGGACCGATGGCTCCTCGGCCTCTCCATCCGCGA
GCACGCGCCCTCGCTATACATGTGCATCCCCAAACATCGCAGAAAGTACCGGACGGTGGC
AGAGGGCACCGCCGGCAATGCCTGGGCGAGGGACATTCACGACACTATTGGCCTTCAGGA
GATTGGGCAGTATCTCCAGATCTGGCTGTTGGTGTCCCGCATCACCCTCTCCTCAGAGCC
GGACACGCTCTCCTGGAAATGGACAGCCAGCGGCAGCTACTCAGCCAGGTCCTGCTATCT
AGCCACCTTCCACGGATCTATCACTTGCCGGTCCTGGAAGTTGATCTGGAAGGGTTGGGC
CCCTCCGAAGGTCAAGTTCTTCCACTGGCTCGCTAATCAGGACCGCTGTTGGACTGCGGA
GCGCCTTGCTCGTCATGGCCTAACGCATCACCCTCGGTGCCTTCTTTGCGACCAAGAACC
GGAGACGATACAACACCTGCTGCTTTCTTGCCCATTCGCGAAGCAGACTTGGCACGTGAT
TATGTCTTGGCTGCGACTACCGGCACCTGTGCCCGACCAGGACGCTCGCTGCAGGATTGG
TGGCTACGCGCTCGTGATGCCACGCCTCACCCGCTCCGCAAAGCGCTGGCCTCGATTGCG
CTTCTCGTGCCTTGGATGATCTGGAAGCATAGGAACGCATGTGTATTTGACCATGTAACC
CCATCGCTAGTTGAGCTTGCCGATGCGATCGCCTTGGATGATCTGGAAGCATAGGAACGC
GTGTGTATTTGACCATGTAACCCCATCGCTAGTTGAGCTCGCCGATGCGATCAAGGACGA
GTCCAGGAATTGGGCGAAGGCAGGGGCCAAGGGGCTTAGGGTCACCCTGCCACCCTCCTG
GGACGTGCATTGATCTGGTTATAACACCTTTGTACTAGCCTCCTAGGAGGTTGTCTCTCC
CTCTTTTCAATACAATGAAACACAAAGTCTTTTGCGTTTTCTCGGAAAAAAATTAGTTAA
TTTGATCCCATCAACTGGGGAAATGGTATGGCAGTGATGACACATTTAAGGCTTGTTTCT
CAATACATTCGCAGTTGCCGCCTAACAGCTTTCGCCCTGCCAGGCTTGAGAGCTAATGCT
GCTAATTCCTTCCTTGGATGTCTGAACCCCATTTCATATTCGTTTCAATTTTAGTTTGTT
GTTTTTGTGTTTGTTTTGTTGCATTGTCTTGTTTCTCAATGGTTTTAGCCCTGCCAGATT
TTATTCTCTCAAGCAGAAATCATCCATTCCAAGGCTTATGTTCCTCATTTAGATGTTGAT
TTTTGTACAAGTCTTTAGTTTTGTATTTTTCTAAATTTAGATTGAAGGTCGGGAAAGCAA
TGGTGGAACATGGAAGCCTCCTCGACAAAGTTGTCCAAGCGTTCATTGCCACCTGAACCT
GAAGACATTGATCTGACATCCGGGAGCATTAGTAGCTTGCGACATTGATTTGACATCCGG
GAGCATTAGTAGCTTGCTGTTTGGTCGGGAAAGAAGAGGGGCAGGTTAGAATTCATCGAG
TGCTAGGTCTGGCGATTTACGCCCTCCTTGTAATCGAAACCACATCCATACAAACCAAAG
CAGGACGTAAGCCTTTACCTCCTCACGAGGGGTTGAACCTGGGTAAATCGCCGTGTTTCT
CCCGCTTAACCCCTTTGAGTCGCCACCAAGGTGCGATGGCTCCAGTACTAAGTCCTTTCA
CGAGGACATCTGCCGTGACAAAACCACGACAGTTGGCGCCCACCGTGGGGCTTGCGCACG
GTGGAGTTGAGTTCTCAAAGGAAGCCCTACCAGGGTTTGGGAGTTACGCGAGATGTTGAA
GACGGCGGTGGTTCAAAACGCCCAGTTCTCACACAGCCTCGAGACGTTGCATTCCACTCC
CCAGGCAAGCTACACCAGGAGCCGGCCAGAGGACCAGCCTGCCGTAAACAGCGGGCCGCG
ACACGTCCCACAGGACAACCCGCCTGATCGGAACCCGCCGGGCCGGGATCTCCCGAACAC
CCAAGACGCCCCGGCCCCCCTCGTCGGGGGCGGAGGGCGAGTTGGGGTGCCATGCTTGGC
CCTCGCCCTTCGTAACGAAAGGATGCCCAAAGATTTTAAGGGACCAACAAAGGTGCCTAA
TTACACCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved