Hordeum_vulgare Locus poly:12:snoZ103
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:12:snoZ103
Hordeum_vulgare
poly:12:snoZ103
chr6H
SNOR75, snoZ103
1001..1088, 1364..1459
2458
ATGTTTACTTGTGTTCTGTCTGTGTGGCTTTGAATTGCTCGCCCCCTCTTACAATTGAT
GCATGCTGCTTGAGTTTAGATTCACAAACTATCTTCTGCACCGAGGGCTGGTTGTAACCA
TATTGAAACAAAACTGATGATTCACTGAGCAACACTGCACCAAAAGAAGAAATATTTGAA
AATATACGGTTTTGCTCACCGTTCACATAGTTTGTTGTCTCCTACTAATGCCATGTCCTT
CATGGATTACATCATATAGATTGATAGCCAAGATTCATTTATCGGAGTCCATTAGGTGGA
TGGATGCCAAGGGGAAAATAAATTATCAAGGAGACAAATTAATGGAAAGCATTCTCAGTA
GAGAAGTGTTAGTAAATAAATTGAATTTATGTGTGGGTCTGTTTTTGTAAATAGCATTGA
ACAACAGCAAAACTGAACTATGTATGTTGTGTCTTCTTAAGCATTCACATGCATGGGCTG
AAAATGCAATGATACATATTTGATTCAGAAATAGGACAGAAAGTACAGACATTTCCTTTA
TATATTCCAAGCAGATCAGACATGAAAGTTATATGGATAGCTTATCTTGTAGCGTAATTC
AGCGCTGTACGTTGCCTAGAGATACTTTGGGTTAAGATTCTAGCACGAACCATTCCTTGA
GACGGTTTTGGCATTCAACTTCTCATACATATCTTAGCACTGAACTGAATTTTGTTTGGA
TAGTGGTATTTGGGATGCCATGAGGTATCTGATGCTTGGTCTGCTTTCATGGCCTTGTTT
CTCGTTCGATTGGCAGTAGATTGTTCTTATACAAGGAGCTTCCTGTTACTATACCCCCGT
TTACAAATATCAACTATATTGTTCTTTCTGCAGTAGATTCATCAGTGATGATCAACACTT
ATTAGGTGTCTCATGATACAGTATATTATTAAACTGTGCATATTCGACATCTGAAGTCAT
GTTTTTGTATCTCTACCCACTCTTAATTTTTTAGCTGGTTCTCTCTATGATGATGAAAAT
AGATGACGAGTCTGATGTAATCCATTCTATTAAACCATGTTGACAATCGAGGCATTTGTA
TGAGAGAGCATTAATTCATTTATTTGTGATTTTTCTGTTTTCAAATATAACTATTTTTGA
CATTAAGACAACAGTTTGTGATCTATTTGATGATAATTTCCTCCAACTTATTCTGAATGT
CTAGTAAGCAGCACATTCTGTCATGGATGCTCTATAGTTGTCTTGTCTTAAGTAAATAGA
AACTCCTATACCATTTTTTGTTTGCTGTGAGAAGTGAAGATATCATATCCATACCACGTT
TCTGCACTTACTGTGATGATCAATTGCTATTTTCCTTGGATTATATGGACCTGAGGATAC
TTTCCCCAAATTATCGACTATGACTATACAATGCACAAATATAATCCCATCAGGATTCCA
AGCCAGAAATCTGATCCATTTTTTATGTCTTACTATTGTCTTCTGGTTAATATTTTGAGT
GCTAGTCAGGTTTCCTTTCTCCAATCTGGCTAAAGAATTACCCCAGTTGACACCAGAAAT
CAACTCAGCATCAAGCTCTATCTAAATCAATAATGCTCTTTGGTAGTCCCTTTTTCATGT
TTTCATTTGATTCGATCTAAAACTTCTGAAGGTAATAAATTAGAGTCTCTGGTGCACTTA
TTGATAGTGTAATTTAGTGATGTATGTTGCCGAAAGGATTTTTTGGGCTAATATTCTTAC
ACCCTGGTATGCACTTGGTTATCACAGTAATGTGGAGTAGCTTGTTTTGTATTATCTTAC
ATGTCTACTAATTATTGTGTCATTGACTCCTACTTGTGTTAGTGCTTAAATTCCTCTAGT
AAAGCGAAAATACCATAAAGATATTGAGTTTGCTTGTCTGCATTTCCTTTGTCCAGAATT
TCCTGGAACAATCTTAGATAGTTTGAAGTTTAATTGTCAGTTTCTGTGACCTGTTTAGGT
TGGACTAATTATACTCCAGAATTTATATATCAGGATTCTTAACATCATCTTGAGGATGAC
ACAAATCTTTTTATTTCTAATATTTCTAATATTTGTTTCCTTTTGATTGATTCCTGTGGA
GTGTATTGTTCTTGTAGGTTGACAAGCTGTGGAATCTCGAGCATGCCTCATAGGAGAGCG
GAATGAAGTCCACTGTACTGTTGGGACAGTAGCAGATGTGCCATTATTCTATTGTGCAAT
TTTGTTCATTCTTGCTATATTCCTGTGTAAGGAAATGTATTCATGAGATGATTTATTGTG
TTATGTAAACCTGGGAGATGTATTTTGTGATGTTATATGATGGATGATTTTAATTCGACT
TGGAGTTTTTTTGATTTGAATATGAAATAATGTTGGATTTAATACTGGACAAATAATTGG
ATTGAAAAGGCCCAACAAATAGAAATGAATCCAAATTTTGGAACAAAAAGTTGCTGAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved