Hordeum_vulgare Locus poly:11:SNOR75
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:11:SNOR75
Hordeum_vulgare
poly:11:SNOR75
chr5H
SNOR75, SNOR75, snoZ105
1001..1092, 1164..1251, 1307..1375
2374
TAAAAGATTTCAGAAATGCATTTTTACTCTATGAAACGTTCGGAAGCTCCGATCCGCAC
TGCCCCGGGTCACCGCTTCTGCATTTGAGAAGGAAGCTATGTCAAACACAAATGAAGTTT
ACCGGATCAAATGAAGTTTCTTGCATCATGTCAATTAGATAAAGCTATGTTTGATTCAGG
CCCTAAATGAAAACGCACAGTTTAAAATCTGTCAGGGACTACAATCCACACAATCTTTCG
TACCTCATACACAATGGCTGTATGATTTTTTCTTTTCAACTATATATGATTATTGAAAAG
CAAACACAAATATTTATCATCTGCAATTCTATAGTCTGAGGAAGAGAAAGAACAGCAAAA
CATCAAACAAGATCGACTGCAGGGACTTATTTCAGAGTACTGCAAAATTAATAGCTGCAT
AAAATTCAGTCACAACCACGCATAATCCTCACATTACATAAAACTCAGTCCTGGAACATA
ACCAGACTAGTATTAAACAGCTAAATTTGACCAAACGCAGGTTAAACAACTTCCACAGCC
ATAACAGCAAACACATCAGGAATCACTAGATCATGCCGTCATCCCTCGGTGCCTAGCTGC
CTGATGTAAAGATGATGCATTCCCTGCTCCAAGGCGCCTACTTGGATCGCTGCCTCATCT
TTCGGCGCTTCCTCTTGAGCCTCCTCATCCTCTTCTTCTTCCACTGCAAATTATAGTAAC
CATGCACCTCATCAGCATAAATTGGATAGATGATCTAGGAAATGCTGATGGACATAACAA
GAATTTCACATTTAAAAGAAGAGATAGTAACCTTTGTTTTGGAATCAGAAGATTGAGTGT
TTCATTGGATATCATCACGTGATTTTCAGAAACACGGACCAATTGTTCTTCATCATGTTC
CAAACTACCATTTCGGCATGGCAAAAAGAAAACTATTCTAATGTCATAGCTATTTACAAA
CTAGTTGAGCAAGACAAAGAGATCTGCAGCGGGTTTGACATTCAGAATGAGTAGGAGGAT
TTTATCGTCAAATAGATCGGACATCAATTTGTCTTCCTCATCATGCCAACCGACGCAATT
AAACTTAAAAAAAAGCTGGGAAAAACACTGGCTAATAAAACGCTGTTCTCTCAGACAAAT
GCCTCGATTGTCCACATGGTTTTATAGAATGGATTACATCGGACTCGTCATCTGTTTTCA
TCATCACAGAGAACTACACGAACAAGCATGCAAGGAAAAAACATCAAATCAGCTAACAGA
AACTGCACAAAGTAATCTAGCAAGTTCTCTCAGACAAATTTGCCTCAGTTTTGTCCCCAC
GGTTGAATGGAATGGATTGGATCGGACATCTAATCAGTGTTGATCATCACAGAGAACCAC
TAATTACGCAAGCGAGCACCAGCAACAGCAAGAACGAACACTCGATAATCACTACCACAT
GTCCAGATCTACCGCGGTTGCGAAGCAGGAAACAACAGGCGAGGTAGACGACGGGCGGCA
GTACAAACCTTGGCCCTCATCGCGGCGTCGGAGTCGGCCTCGCTCTCCGGTTCGCAGCGG
CGGAGACGGCGGCGGAGGTGTGTGGACGAACCCGATCTCCGTAGATTGTTGGCGGCGGCG
GCTCTCGCCTCGTACTTATAGGGATGGGGTGATGGGGAGGGGAAAACCCTAGCGGGTGGA
CGGCTCGGATCGGCCAGTGAACGTCGTTCTGATCCGATTTGGTTGGGCTGTGGTTCGTAG
GCCTAATTGGGCCTCCAAACCAACGCCTCGGCCCACGCTCACATAGAAAGATGATGGGCC
TTCTCTTCAGTCTTGTTTTCTGTAAACTGGGTCTTCTCCTCACTTATTACTCGGCCTGAT
CGGTTCTGCTAAAAAGAAACAAGAATTTCTCAGGAAAAAATAAAACCAAGATGAAAAGCA
TGCATTGCTCGACTGCTTGAGGGGCTAGTTAAACGTCTTGATGAGCAGCAATGGTATCTG
AACCGATCAATGTTTGACCGCTCGCGTGGATTAAACGTCTTGACTGCTCATTTGTTTGAA
TATGTAGCTTGCTCCACCGCTGGCGAGGATTTTATCAAGAACGCTTGTCGCACATCATGA
GAAGATCTCTGAATATTTAGCTTTGTAATTAGCCGTTTGTCTGAATTGTCTGGATATCGG
AATTATAGAGAACTATAAACAGCTGCGGCACAGCTCAAATTATACCGATCAGGCCACATG
ACATTCATATCGACAGTACGGCAATGCATGAGATTAGAAGAGGATTCAAACTACGAAGGA
TCATTTTGCAAAAAAGTCAATCGTTGCTCAAATGCCAGATAAACAGGTTTGGATACAGGA
CAATGTCTGGTTGGTTCAACTCATAACATCGATAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved