Hordeum_vulgare Locus poly:10:SNOR75
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:10:SNOR75
Hordeum_vulgare
poly:10:SNOR75
chr5H
SNOR75, SNOR75
1001..1088, 1204..1296
2295
CAAGACCTCAGCATCCAAGTTGCAGCTGACGCTTGCCCTTGCACCTGAGTTTGAGTGCT
TGGGCCAGGATAACCATGTGCCTGGGTGGAATAAAGCCACGCAAGCCATCGACTCTCCAG
GACGCATACCAAACATCCACACCTTATGACTATGAATCAAACCAAACAACCTCAAGAATC
ATTATTGTTTAACAAGTTTTCACGATGCCACTCATTTCGAAGTCTTGGTGCTTGAGTGTA
CCATATTTGCATCAACAAATCATTTTATCTTCACACGAGTTGTACCAAACAAAAGAGGCT
AAAATGTGTTGAACATGTGTTTGGTTAGGACGACAAACATTGTTAATCACAGGTCACAAG
AATATTCCCGTCCCTGTGTGAACTAACTTCTAGGAAGGGAACTGCAAAGATGATACTCTA
TGCTACTTGTGCCCCAGTTGCTTGAGGTAATAAGCTTGCACATGGTGAAGTTATTTTCAA
GTCCCTCCCCCTACAACTTTCATGTATCTACGTACCGTCGCAAATATGAATGGTGGTGAG
TGAATGATAGAAGGTATCAATCTATTACTAGTGGAATCTATCATTTGACAATGGCTGGCA
AAGAGGTCGTGCTCAAGGTCAGGGCCTCACATATTTCACACTTGAGTGAAAATATCTTCT
GCATCACGGGCTAGCTTAAAGCCGATGTGACCAAATATCAATATTTTCTCATGGACACTT
TTTATACAATGGAAGAATCACTAGGATGAAACATTCAATGCACACACCTAATTTTGGTAG
GTGTGTACAAACAAATAGCAACCATGCTACACAATGATATGGTAACCTGGAAACAACCAC
TTTAATTTAAACCACCGACAAGAAGCAACACATAATTTTCTTTGTGTTGCTACTACATAT
TAGATGGAGTGTGTGTGCACGTGTTTATAAGAAAAGATTTTCTAGGCCACCCATGAGCCA
TGACATTCAAGCCAAATCCTTGATATACCAAGGATTATTGTTCTCTATGATGATGAACAT
CAATTAAGAGTCTGATGTAATCTATTATACTAAATCATGTGGAATATTGAGGCATTTGTT
TGGGAGAATACTTATTAAACTTGCCTCGGCCTTTAATTTGTCTGCTTTTTCGTCATTATG
CATGCGTATTTGTTTTGCTTGACTAGTGATGGTAGGTAGAAATAGTTGATATTGTTGTGT
TTGTTCTTTTTGGTGATTAAAACATATGACAAGTGTGATGTAACCCATTGTATTCTGTTA
AACCATGTGGATAATCAAGGCATTTGTATGAGAGAACATGCTCAGTCTTTAACTTTGTGA
CTCAATTTTAGGATTAACTGCATTGTTGGCCCAATGAGGAAAACAATTGTTGTATGATCC
ACCTGATGACAGAATCTTCCTTCATATTCGAAGTTCAAAACAACTTCATATTTGCTCTCT
TCTGGAGAAAGATTCATCTCACTCTTACATTCTTATATGCTTTCTGTTTGTTCATCTAAC
CCACTAATCATCACGGGATGAGGCCGATCAAATCTGAACACTTAATACTCATGTTTGCAA
CAATTAAACTATATTGTTGTCTTCTCCTACTTTGTACTCTTTACGTTTTAAAATATATTG
CACATCCTTTTGCAATTATATGTGGTGGAAAAATAAGACAATGAGGAGGATCAAGAGGAA
GCTCCAAAAGATGAGGCATGAGTCAAAGTACATGAGCAACAAGGAGAGGAAGCTTCATCT
TTCATCATTTTATGGGTCCATCTCGGCTCATATGTCCCGGTGGTTCTTATTGTGGGAGAT
GTGAAACTTTGTAATATGATGATGATTTGATGACCATATTTTATTTTATTTTATTTCTGA
GTGTTAATCACTCATCAGATATTTGTAACACAAAAATATAATTTCCTGCTTTCCTCTAAC
CATCTGAGCAAATTGTTTGGCTCATCAACATGTTATTTTGTGACGTGGTACTTTCTTCAA
TCTTTTGGTTCAAACCATGCCAAGAAATAAACATGTTTCTATTTCTATGGCATGTTTGCC
TGCGCATCGTGGTTAGCTATTGAATGGAAGGATTGCTAATCTGTTCTCTCACTGAGAGGT
TATTGTTTTTCTTTCTCTTGTACATTCGTGAAAAGGAGTAGGATGTTATGCCACCCACTT
GGAGTTTACCCTTGCATGCAGTTTGATCAAGGATTTCCCATTCATAATAAATACTGAATT
TAGAGAAGTCACCCAGATGTCGACCATAAGAAAATAATATATTTTATATCTGAAATGTGC
CACTTGGGCGGAAAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved