Hordeum_vulgare Locus poly:1:snoZ221_snoR21b
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:1:snoZ221_snoR21b
Hordeum_vulgare
poly:1:snoZ221_snoR21b
chr1H
snoZ221_snoR21b, snoZ221_snoR21b
1001..1095, 1433..1525
2524
AGGCTGCCGACAGCGCATGAAGGACGAGTCACTGTAGATCCTGGACCCATTCAAAGTGC
TCCCTCGCGTCATCGCTATAGATCCTAGACATATTCAAAGTACTCCCTCGTCTCGTCGCC
ATCGACCTCGACTAGACCCTATGGCCCTTTTGCTGGTACGTGCTCGTCCCGCTCTTCAAT
CCGGTGGACATGTTTGTTTTGTAGATAAATTTTTTATCACTGCAAGGGAATATTACCTAT
CATATACACAACTCAATAGCATGTATGCTTTCCCGAATTGAAACCATGAGTGAAATGGCT
GGACAAGATAGAATACTACATATGTGTGATGTGGTCTACTTCCGTATAAGTCTCGCAAGG
ATAAAATTATCCATTGGAAATGTTTAACACGGAGAGAAACATTTTGTGAGTTGGGGAGGG
GGAACAAAGTTAATTTGGTGTGCCGTTACTTGCTAGCTTAGCTTCTTATTCTTGGTCACC
TTTAAAGATTATAAAAGAATTAGAACAACCATGATTCCAATGCTGCTCGCTGGAAAACAT
AAATTTCCTATATACTTTCTGTTGTGCCTCACTTTAATGTTGTTAATGGACCCTTGATTG
AATTTTCTTTCATCAAGGAATGCCGCTTCAAAAGTGAGTCATTGAGCCTCGACATGGCAA
TTGTGTTTCACCCACAAATATTTATCTTTTTTTTTGTTGTGGCCTTCTTGTGAACTTAAG
ATTTCTCAATGATGGATTATGTGTGCAAAATGGATGCTTTGTGGATTCAAGCCCCTGTTT
CAGGGTGAGCCACTTTATGAACCAGATATAATATGACATCAATCGACAAATGTAAGATAT
TGTATAAATTATAATATTACGTTGCTTTAGTTCCTGGTTATTTTAATAATAAGATTGATT
GAGGTGTGATTTCTTGTGCTTACTGCTGTGTATTACAAATCAGAAGTGTTATATATTGTG
CTTCCTGAAGTAATACATGACGTTTTGCTTCCTAGCGAGGTAAAATGCTATGATGAGAAA
TCTATGCACCACTCTGGAGAGATTTATCTTTTTGTGTTGATAAACAAACTTAAAACCCAT
TTTATATCTGAGTTGTCTCATGGATACCAACTTATGTAATTCTTGTTTATTGGCTATTCA
TGCTATCGATGTAGTACTTTTTTTCAGAAACATTTTCCTTCTTTTTCCATTGGGAATTTT
TTAGTTTTGAAAATTAAAGTCTTAAGATAATGGTGGGGGGAATAATGTAGGGAACCAGAT
GATGGGGGTTGACCAAGTGCGATCCTACCATTGTCTCAATTGGTTGGTACTTTATTTTTC
CTTTAGCCGTTTAGTTCTTCAATATGTTTCCCGAACCTTGTTGCACTGCATATCAATTGC
TTGGTTTTGTATTATTAATTATGGCTGCAAAATGGATCCTTTGTATAAGAAAAAGTCTAT
GATGAGAAAAGCCATGCACTACTCTGAAGAGATCTATCTCTCTGTGTTGATAAACAAACT
TACAACCCATTTTATGTCTGAGCCGCCTTGGGCATACATGCTTTACTATTTTCTGGTGCA
ACCTTTAGCTGGATGTGGGGATGGAATTAACACACATATTTTGCACAATCTATTTGTGTT
TTTTTGCAATCAGTATTGCTAATACCTCCGCGTGTCTTTAACATTTGCTTTCTCTCGTGG
ACACATGTATGAACACTTCACTTGTCTTCATTCTCAATTTTCTAGGTTCTTTATTACTCC
CCCTCTAAAGAAAAATAAGAGCGTTTATAGATCAATACTAAGTTCTCTTATATTTATTTA
CGGAGGGAGGGATTTCTTCTAGATTGTAAAAGTTGTATGCTTCACTTTAATGCATGTGTG
ACATAGTGACAGCAATAGAGCAAATTATCTCATGGAGGGTTCATGATATAATTTGATATA
GATTTTCATTTAATTAAGTTGTCTACTTTAGTATTTAAGCTCTGTTTATTTGCACTTAAT
TGATATGCATTTGAACTTCCTAGTATTTAATACTTGTAATAACTAATTTAAGGAAGAGAC
CCAAGCTGGGTTGTGTAGCCACGTAAACCCCCTAAATGATCACTACTTGCATCCATGACT
TGCTTATACGCTATTTGTAGTCTACTCTCAGCTTGTTGCATTTTACTCATGTCATGTTAT
GCTTAATTTTCCGCATGTGTTGTCTGATGATCCACAAGTATAGGGGATCAATCGTAGCCC
TTTCGATAAGTAAGAGTGTCGAACCCAACGAGGAGCAGAAGGATCTGACAAGTGATTTTC
AGCAAGGTAAAATCTGCAAGCACTGAAATTATCGGTAACAAGTGATTGTGTGGTGAGATG
ATTCGTAGCAAGCAACAAGTAAAAAAAGTAGCAACGGAGCAGAAAAGTGGCCCAATCCCT
TTTGTAGCAAGGGACAAGCCTGGACAAAGTCTTACAGGAGGAAAAACGCTCCCGAGGAGA
CACGGGAATTTCTGTCATGCTAGTTTCATCATGTTCATATGATTCGCGTTCTTTACTTTG
ATAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved