Hordeum_vulgare Locus poly:1:snoZ103
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:1:snoZ103
Hordeum_vulgare
poly:1:snoZ103
chr4H
snoZ159, snoZ103, snoZ103
1001..1095, 3152..3241, 3370..3465
2095
CGTTTGCTGACATCCGATTAAGTTTGGTCAAACAAAATACCTCTAGTTTTGTAGTGTGT
GTTTTCAGTCCTATAATGATGAAATTTGTGGAACGAGCTACGATTCAGGTAGCCCCTTTT
TCTGATTTCAGTGGCAATGGAGGTGTTGCGTTGCTCACTGGCAAGGGAACAAAAATACTA
TGAATCACAGGAGGCCTTATGAACAAGATATTTGACTGAACATGATCAGAGGTTTGACTG
AAAAAACAACCTCATGATCTTAAACTCGCTCGTAATGAACGTGATCTTTAACTGACTGGA
CAATTGAAAGAAAACACATAATAGTGGCACGGCTATTTATTTGGTTTCATATATTTATAA
TTGTTCCTTACAAACCATGAATAACTACAATTCTTACCTATCTAACAATTGAATGAGTAA
ATCCTCTGCTCTTCAGATGAGCTGAGGGGGAGGCTCTGCTTCACAACTTGAAGAATGGCC
TGTTGTTAACAGTTTGGTCATCCTGTTGAGGGAAGCATAGATGAATGGAAACACCGGACA
GCATTAAACAACATTGCCGCTTTATCAAACTGCGTCCTATTACCTGTCTTTTGGCACATT
TGTTACCATTAGACAATGTGACTATTTCTTTTCTTGAGATTTTATTTTTGTTTGTGATTT
CGTTGTTTCATTTGGTGGACGTGACATAATTTTGATTTCTTGATGTTTTGTTCTGTAAAC
AATCAATTCTGGTGGTGTTTCATTTCTTTTAGTTTCTGTTCTGAGATTGCGTTCTCGATT
TAGATGGAAGTGAGTATCCTTTCCCCAGCTTATCGACTATGATTATACTGTGCGCAAATA
TCTGAGTATTCTAAGCGAGAAATCTGATCCATCTTGCCCAACAATCCCTGCCCCCTGTTC
TCTGTTCGTATTTTACCTTTGTTTTCTCTGTTTATATTTTACCCTTTTTTTCTCTTTGTT
GGTATTTTACCTTTATTTTTCTGTTCGTATTTGTAAATTGGATGGAAGTGAGGATCCTTT
CCCCAAATGATCGACCATGATTATACTGTGCACAGCTGTAATCCCACCGGGATTCCAAGC
CAGAAATCTGATCCATCTTTGTTATCTTTGCCACCCTGTTTTTTTTATTTCGTTTTGTTT
TTACTATTGATAAACTGAATTGAAGTGAGGATCGTTTCGTTTTGTTTGTTAGTCCCTCTG
AATTAGTATATATTAGTCGGCTTGTCACCAGATAATCCTCTTAGTCGGTGAGGCATTACG
CGATGCTTGCCTCGATAGTTACCCATCCGCCCATAATGTAAGACGTTTTTGCAAGGTAGT
TTTATTCTTATGCATTAAAAGGATTTGCATGCATAATAGGTGTCATCTGTTTGTAAATTA
ATTTCAGTTTTTGGGTTCTGTTTTATGATGGGCTGAGGTGATGCTAAAACAAGATATTCC
TGAGATTTTCTTTGAGGAATACAATATCTAATGTTTGTTTTCTTCTATACACTTGCACAT
GTTTTATCCATTACTCCGTCCCATATGATTGTAGCTTCTGCTGTGAATAGCTACAATATA
CAATGGGCATCTACAATACTTATTCCCATAAAAGAATTGTACATGATCCAATACTCAATT
ATCTGTTTAGTCTAGTAGTCTTAAAAACATCATCTGTTTCACTCAATACTCAATTTTTTT
GTTGGCATTCTGACTTGCCAATGGAAAAACCATATGAATCTTTGACCTGTTCGGTTTAAC
ATTTTAGTTCATGGTGCATTATGTGTATAGATCCAACGATGGACAACTATTGCATCATTG
GCATCGGAAGCTCAAGAACACTCATGACAAACAAGATCAGGCCTTTTATTTATTTATCAA
AATAAACAATTAACATTATCTCAACTTACTCACAGTGAACACATGATCAGGCCTTTTGAT
CTAAGTATACAATTAACATTGATCTTAACTGACTCATGGTCATTTAACTGACTCACCATG
AACACAGCCCTTTAACTGACCAAACTGACCAAACAATTAAAGGCAAACAGTTCGGCGCAG
CTCGATTTCCTATACAAAGATGCTTAAATAACGCTGACATTTGTTTTTTAAGAATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved