Hordeum_vulgare Locus poly:1:snoZ103
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:1:snoZ103
Hordeum_vulgare
poly:1:snoZ103
chr1H
snoZ103, snoZ103
1001..1100, 1235..1330
2329
TGTTTAAACATCACTTTTTTCGAGCAGGCAGTCAGTTTTGTCCCGTGATGAACAAACTA
AATACTTCCATTCTTCTAATGCAATATCTCATAGCTTTTGGTTACCTACCCGAGGGAGCT
ATGGATGGACAGCCCTGCCCGTGCTGTGTCTAGTTTGCCTTCGGATAATAACAAGTGAAT
GTTCATTAATGATCTTGCTTTCAAACTCTATTTTTCTTGAGATAAAAGCGTTTGCTGACA
TTCGATTAAGTTTGGTCAAACAAAATACCTAGTTTTGTAGTGTGTGTTTTCAGTCCTATA
ATCATGAAATTTATGGAACGAGCTACGATTCAGGTAGCCCCTTTGTCTGATTTCAGTGGC
AATAGAGGTGTTGCGTTGCTCAGTGGCAATGGAACAAAAATACTATGAATCACAGGAGGC
CTTATGAACAGGATATTTGACTGAACATGATCAGACGTTTGACTGAAAAAACAACCTCAT
GATCTTAAGCTGACTCGAAATGAACGTGATCTTTAACTGACTGAACAATTGAAAGCAAAC
ACATAATAATGACACAGCTATTTATTTGGTTTCATATATTTACAATTGTTCCTTACAAAC
CATGAATAACTCCAATTCTTACCTATCTAACAACTGAATGAGTAAATCCTCTGCTCTTCA
GATGAGCTGAGGGGGAGGATCTGCTTCACAAGTGGAACCTGTTGTTAACAGTTTGGTCAT
CCTGTAGAGGGAAGCATAGATGAATGGAAACACCGGCCAGCATTAAACAGCATGCCGCTT
TATCAAACTGCGTCTTGTTACCTGTCTTTTGGCACATTTTGTAGCATTAGACAATGTGAC
TATTTCTTTTCTTGAGATTTTATTTTTGTTTGTGATTTTGTTGTTTCATTTGGTGGACGT
GACATAATTTTGATTTCTTGATGTTTTGTTCTGTAAACAATCAATTCTGGCGGTGTTTCA
TTTCTTTTAGTTTCTGTTCTGAGATTGCGTTCTCGATTTAGATGGAAGTGAGTATCCATT
CCCCAGCTTATCGACTATGCTTATACTGTGCGCAAATGTAATCATTTATCAGAGTATTCC
AAGCCAGAAATCTGATCCATCTTGCCCAACAATCTCTGCCCCCCCTGTTCTCTGTTCGTA
TTTTACCTTTGTTTTCTCTGTTTATATTTTACCCTTTTTTTTCTTCTCTTTGTTGGTATT
TTACCTTTATTTTTCTGTTTGTATTTGTAAATTGGATGGAAGTGAGGATCCTTTCCCCAA
ATGATCGACCATGATTATACTGTGCACAACTGTAATCCCACTGGGATTCCAAGCCAGAAA
TCTGATCCATCTTTGTTATCTTTGCCACCCTGTTTTTTTTTATTTTCGTTTTGTTTGTTA
GTCCCTCTGGATGAGTATATATTAGTCGGCTTGTCACCAGATAATCCTCTTAGTCGGTCA
GGCATGACGCGATGTTTGCCTCGATAGTTACCCATCTGACCATAATGTAAGACGTTTTTG
CAAGGTAGTACTCCCTCCGTTCCTAAATATAAGTCTTTGTAGAGATTTCACTAGTGGACT
ATATACGGATGTATATAGACATACTTTAGAGTATAGATTTAATCATTTTGCTCCGTATGT
AGACCCTTAGTGAAATTGCTTAAAAGACTTATATTTAGGAACGGAGGAAGTATTATTCTT
ATGCATTAAAAGGATCTGCATGCATAGTAGGTGTCATCTGTTTGTAAATTAATTTCAGTT
TTTGGGTTTTGTTTTATGATGGGCTGAGGTGATGCTAAAACAAGATATTTCTGAGATTTT
CTTTGAGGAATACAATATCTAATGTTTGTTTTCTTCTATACACTTGCACATGTTTTAGCC
AGTACTCCGTACCATATGATTGTAGCTTCTGCTGTGAGTAGTTTTAGTAACTTGACATCT
GATTTACTTAGTACCAAGAATGAAGTAGTTGCACTTGGTAGATGGGCTGAGCAAATGATT
TACGGACTAACAAACCATGAATAGCTACAATATACAATGGGCATCTACAATACTTGTTCC
CATAAAAGAATTGTACATGATCCAATACTCAATTATCCGTTTAGTCTAGTAGTCTTAAAA
ACATCATTTGTTTCACTCAATACTCAATTTTTTGTTGGCATTCTGACTTGCCAATGGAAA
AACCATATGAATCTTTGACCTGTTCGGTTCAACAATTTAGTTCATGGTGCATTATGCGTA
TAGATCCAACGATGGACAACTGTTGCATCATTGGCATCGGAAGCTCAAGAACACTCATGA
TAAACAAGATCAGGCCTTTTATTTATTTATCAAATAAACATTTAACATGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved