Hordeum_vulgare Locus poly:1:snosnR60_Z15
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:1:snosnR60_Z15
Hordeum_vulgare
poly:1:snosnR60_Z15
chr1H
snosnR60_Z15, snoZ43, snoU31b, snoR77Y, SNORD14, snosnR60_Z15, snoZ43, snoU31b
1001..1095, 1175..1271, 1929..2016, 2769..2850, 3183..3304, 4289..4383, 4452..4547, 5207..5294
6293
CCCTGTCCTACTTTTTAGAAGAAAAAAATCTAAAAAATTCTGAAAATTGAGACGTTACG
CTCCATGATCACATTGATGTTTTTCTGCACATAGTAATCTTCATGTAGTCGCAATTCCAT
CGTGACGTCGACTACCGATGATGAGTGGGAAATCAAAAGGCATACGGTATTCTTAGCTTT
CTACCTGATATTTTAACTTCCCTTGTTTTTAACTAATTCTTCTCTCATCTCCTTTATGAA
GCTGATGTACATATATTTAAGAAATTAAATCATTTTCTTTGGGGTTGGAAAACCAAGCAA
CATATTTTTTTAGGGCTGGAAAACCAAGCAACAAGGAGGCGAAGGAGCAAGCGATGGGAT
GGGCTCGTCGGCCCCGTTAGTTCTGGGCCTACGGGCCGAGCAGATTACACGAACGCATCC
AGCGCCCCTGTAATCTGCCCTAACGGGAGCCCCTCTATATTAATCACCAACGAAGAGGTC
GGTCTTCCCCACGCCGCCTCCTCCCATCCCATCTCTTCTCGGCCTCGGCCTCGACCTCGA
CCTCGATCTGTTCGTTCTTCCTGATCTGTTCGTTCTTCCTGGGGTGATTTGGGTATTGCC
ATCTGGGTATTGAGCACGGCGGGAATTGACATCTCTTGTTCCTATCTCTTCTGGATTACA
AACACATCTCTCCCAACTAGTGCATTCTTCTTGTGATTTGTTCTTGTTTTCCTCTTTTCT
TATCGGTGGCCGAGGTTTAAGCTGAATCATAGACAAGCATATGTCCGAATTCTCTTCATG
TGGAGCGATCTAATCTTCTCTATGAGGCCAGGCCAGAGATCTTGCTCGTTTCTTGATCCG
CAGTTTTATTAGATGCGGTTCGTGGTTCCGATGATGATTAGTGTGAACTTTTCTCAATGA
AATCGCTAGTGATTACATAACCTACTGCCTTCCTTCTGAGGGCCCACGATTCCCGCTCCT
TTTCTCTGTCGGTTTTGTTCCTGTTTATCTCTGGGCTAAGGTCGGGTCGGATGATGATCA
CAAGTGCATAGTTCATATGATCAAATCGTGATTACTTGAACAAAAATAGTCTTTCGCTCC
TATCTGACGGCCTTGCAACCTCCCCTTTCTCAAACAATATGTTTATCCTTTTTACTTTTT
ATGTTTTGCAACCCCATGTCTGAATTTGTTGTAGAGGACGGTGAAGATTGATATTTGGTC
TCGTTCGTCGTAACTGGCGTTTACTTGCCTTGCCGACCATCCTGCTATATCACCACCCAT
ATTCTGAGTCCTTAATTATTCAGTTTTAGTTTTGTTGTTTGGCCTACTATTAATATAAAC
TAGTGGGCAAGCATATGTCTCAATTCTCTCTTCCATGTGGAAAGCATAATTAGCAATGCG
GTCAAAATCTGATTGCTTTTGTACTATATAACCATATAACTTGTCTGACGTAGGCTGATC
ATGACATTATAGTCACAGATTACCAAACTGTGATTGCATCCAGAAAGTAGTATTGCTCTT
GTAGCTGACGAACTGCTTTCCTGTTTAATTTCAGTTCAAATTGCATATGGGAATCCATGC
CCTGCCCAGTAAGGCTATTTAGATTTACGAATGATTTTGGAGAATTGTATTATTTACTTG
AATTTGGAGCAGTGACGAGACAATTCGCTTATGATCTCTGAGGTGTGATTATAATTGCTA
CGTTCTTACCGAGCTCTGTTTCATATGTTCAGAACTGTAATGATAATTCCACTGAACACT
AGAAAGCCATTCTATTACACATTACATGTAACCTGTCACATAGTACTAGTTTCATAATAG
AGAAATGACAGAATTAAGAATAATACATCTTTTTTTTTATGCGGCACTAGTGTAGTTCAA
CTATTTTTGAATTGGTAGACTATGTACAAAAGTTACTTTGATGTTTGCAATGATTCTCCA
AACCAGTTTGAGGATGATGATTTCATATTTGTCGCCCCAGTCTTAGGATCCGCCTAGGTG
GATCTGTGCTGATTGACATACTTCTGAATCTGACTCGGCAGACGAAAATTTTGAACAGTT
GGTTCGATTTTCTTTTCTACTTATTTTTCTTGGCTGGTGGTAGTGACGATTTGCAAAATT
CAAACACAACAGACAAAATCACAGGTTTTCTCTCAGGAGTTCATTTGTATGCTGACGTGT
TTGTTTGAATTTTGATTGGCAGTGACGATGGCAGTGACGATTGGCAGTGACGATTATCCT
GCTGAATTGGGCCATGTGACACTTGAGGTTTTAATACTGACGTTCATTGTTCTTGTCTCT
GGATCCTTCATTTCCATGCTTCTTTTCGTGGTTAATGTTTTATTTGTATTGGAGTGCTTA
ATGTTTTGTTTGTATTGGAGGACGTAGTTGCGATGAGGATAACAAGCTCCCTCTTCTGAA
AGCATTGATGATATCGCTGGCAGAATCGAACCAAATAAATATTGCCACCACTGAGCAACT
CTGTATCTTTGTACAATCTTTGTTGCTTCTTCTTACTTCTACAAGGTATGTTTGGATCGT
GAGGAAGTATTGATGCATAATCCAACACTTGATCCGAGGGCAGCTTGAGCCGCCCATATG
ATGTCATCTTTGCAACTGAATCCATTCGAGTTCAGTGTTATTTTTTCTAAACATTGAAAC
AATCTCAGGACACCTTCATACACAGTGCTTAATTTTCTGTGAATGATAAGGCATTTATGT
TCTGATGATATATCTTATTTTCATCGTTTCTTACATTCTGTGTTCCAAGTTAGATCTATA
ATGCACTTGAAGCCCATGATGATTAGCTTTATGTTGGAATTACCGTCAGATACCCAATGA
CGATATTTTTGCGGCTTTCTGAGGCTTAAAACCTATATCTTCCGGTCTTCTGTACTTTTT
GCATTGTTAATTTTGTTCATCTTAAATTCCGTGTGAAGATTCTCAGACCATAGGAAGTGC
CGTATGACACTGTAAACTGGTGCTTCTGACACTGTAAACTTTGTGGTTTGGTCTGTTCCG
AAATCTCTATTTGCAGCTGGTATGGTTCAGCTGTTTGCGTGATTTTAAGTGGTTCTCCGA
GGGATTCTCTTGAATTCTGTTAGCATTGTATATGGTTTGTCCAAATAGCTGGTTATTGTG
ATGATTTTTTTAGAATAGCTAACCGGTTGTGATAAATATGGTGATCAATTGGGGATGCAT
TTATGGCAATGATGATACGTTAAGGGCTTGTTTCTCAAAACATTCGCAGTTGCCGCCTAA
GAGCTTTCGCCCTGCCAGGCTTGAGAGCTAATGCTGCTAATTCCTTCCTTGGATGTCTGA
GCCTTATAATATCCTCAATTTATCATTTTTTTTCTCTTAATTATTCCGTCTTCTCCTCTT
TGATGCTTTAATCTTGTTAAATGTTACTTTGTTCTGTTGGTTTCACTTGGTGAGCACTGT
TCCATGTCAGTCTGCCGTTCTCTTGGTGGATCTGAGTTTACAACGCTCCCAAAAGGTGTT
CTGGTGGTGCATAGAGCACAAAACCGTGTAGATCTTTGGTTACGCTCGCCCCCAAATTCC
AGTTTAATCTCTACTTTTCTATCTTTTTTTGCTTGTATGTTTTTTATAATGGGATTGATT
ATATAGTGATTTGAACCTTTGTTGGTGCAGTGATTATATAACATTCCTCGTGCTGATGGG
AAATCCCTATGAAGACACCTGTACATCCATAGAATCTGAGCTCCAACAAACATTGTTTCT
TCTTTTGCCATTGGTTTCTTAATTTTTCTTTTTTATTTATTTCCGTTTTGCTTTGTTAGT
GGTAGTGGCTGATGATTAAACTAAGTTATAGACAAGCATATGTCTGAATTTTCTTCATGT
GGAATGATCTAATCTTCTCTATGAGGCCAATGATCTTGCTCGTTTCTTAATCTTCAGTTT
TATTCGATGTGTGATGCCGATGATGATTAGTGTGGACCTTTCTTTTTTGAAACCACTAAT
TACACCCATTAAGGCGTGTGAGTAAGGCAGCCAACCAGGTATATGCCACATGGCGCATGC
TTGTTGGTTGTGGTGATTTTATTTTTATTTTTATGGAGATTATTTTTGGAAGATGGAAGT
AAGGTTCTTTTTTGAGGAAATATTATGTAGGTTTTTCCTATTTCTTTTAAGATGATGTGA
TTTCTCTTGATGCGAGAATATTTTTTTGATTTTGATATACAGTGAGGCTTTTTTCTCTGA
AAAAATGGAGAAACATGCGCACAACTTCCTCTCAAGCGGCCCGCATGGAGGCTTTTTTCT
GTCGGTTTTGTTCCTGTTTTTCTTTGTGCCAAGGTCGGATGATGATCACAAGTGCATAGT
TCATATGATCAAATCGTGATTACTTGAACTAAAATAGTCTTTCGCTCCTATCTGACGGCC
TTATGACCTTCCCTTTTCTGAGGAGAATCTGTTTGTTATGTTTTGCAAGCGCATGTCTGA
ATTTGTTGTAGAGGACGGTGAAGATTGATATTTGGTCTCGTTCGTCGTAACTGGCATTTA
CTGCCTTGCCGACCATCCTGCTATATCACCACCCATATTCTGAGTCCTTAATTATTCAGT
TTTAGTTTTGTTGTTTGGCCTACTATTAATATAAACTAGTGGGCAAGCATAAGTCTCGAT
TCTCTCTTCCATGTGGAAAGCATAGTTAGCAATGCGGTCAAAATCTGATTGCTTTTGTAC
TATATAACCATATAACTTGTCTGACGTAGGCTGATCATGACAGTATAGTCACATATTACC
AAACTGTGATTAAATCCACAAAGTAGTCTTGCTCTTTTAGCTGATGAACTTTAGCTTTCC
TGTTTAAATTCAGTTCAAATTGCATATGAGAAACCATACCCTACACAGTAAGGCTATTTA
GATTTATGAATGGTTTAGGAGAATTGTATTATTTACTTGAATTTGGAGCAGTGACGAGAC
AATTCGCTTATGATCTCTGAGGTGTGATTATAGTTGCTACGTTCTTACTGAGCTCTGTTT
CATATGTTCAGAACTGTAATGATAATTCCACTGAACACTAGAAAGCCATTCTATTACACA
TTACATGTAACCTGTCACATCGTACTAGTTTCATAATAGAGAAATGACAGAATTAAGAAT
AATACATCTTTTTTTTATGCGGCACTAGTGTAGTTGAACTATTTTTGAATTGGTAGACTA
TGTACAAAAGTTACTTTGATGTTTGCAATGATTCTCCAAACCAGTTTGAGGATGATGATT
TCATATTTGTCGCCCCAGTCTTAGGATCCGCCTAGGTGGATCTGTGCTGATTGACATACT
TCTGAATCTGACTCAGCAGACGAAAATTTTGAACAGTTGGTTTGATTTTCATTTCTACTT
ATTTTTCTTGCCTGATGGTAGTGACGATTTGCAAAATTCAAACACAACAGACAAAATCAC
AGGTTTTCTCTCAGGAGTTCATTTGTATGCTGACGTGTTTGTTTGAATTTTGATTGGCAG
TGACGATGGCAGTGACGATTATCCTGCTGAACTGGGCTTTCTAGTATCAGTCTCCATGAG
GCTTTCTTTTTGATCTCGTTTCTGCACACAACAAATGCTACTTGGAATCAGTCCCTTTGG
CACTTATCTGGGCATGGTCCTTGATGATGTTGGCTCTACGCCAGATCATAACAGCCAATG
GTGCTCCGAAACCTGACACTCCAACTGAATCAAGAACGACAATCTAAATAAGCTACTAGC
CTTCTCTTTGCTCTTCTTTTCAGTGCACATCTTAATTTTCTTACTGTGAATATACCATGA
TGTTGCCATGGCTGCTCTTAATTTGATGCTCTCTAGGATTCATGAATAAACCAACAAGTT
TACTTAGTTTGAGGTTCTGAAACTGCATCTTTGTGCATGCGCTCCGGTCACAAGTATAAT
TTGCAACCTTTGAAAGTCACAGAGGGGTATTCAAGATGGAAATCATCGTCAAATGGATCT
ATAAATTGATCATGGATTACCAACCTGGCTTTTCTTGTGCAGTACAAAGAATGTTTAGAT
TCTGAAATTGCATGCGTAATGGCCATAGACAAGTCACAACCATTCAACAAAAGCTGATCA
AAGAAGTACAAGTACTTAATCGACCTATGTAATTAGTTTTAACACTCCCCTTAATCTACG
CTTGACCATGTGGAGTCATCTTCATGATTGTCCGGGAAGCTTTATCATCAAAAACTCTTC
TTCAAAAGTTCTTCATAAAGACTTTGATGAAAACCAAATGTAAACTCAGAAAGAGATAGC
ATAATGTGATTTTATTGAACAAGGATATCTCAAGAAGAGACTCCCCCTGTTGTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved