Hordeum_vulgare Locus poly:1:SNORD14
snOPY snoRNA Orthological Gene Database
Hordeum_vulgare poly:1:SNORD14
Hordeum_vulgare
poly:1:SNORD14
chr6H
snoR31_Z110_Z27, snoR77Y, SNORD14, SNORD14
1001..1098, 1162..1243, 1543..1664, 1733..1853
2852
CCGGCCTAATCAACTGTTGGCTGGATGCAAACGGCCGAAAGTTTCCCTTAGCAGTTTCT
TTTAGGTGCCCTTAGCAGTTCGCTGCAGGCGTGCGGCGAGCAGAGGTCTCAGGTCACTCG
TAGGCCGCCATTGCGCTCCGTACCCGGCCAGGGGCCTAGTGCTGCCATATGGGCTGTACT
GAAAGGGTTATGCACAAATCTGTAGTTTGTTCCAAGCCCAGTTCAAACAAAAAGTTCCGT
GTGAGCAGGTAGAAGTGAAATCGCGGCCCACGGCGAAGTATCCGCAGACACGCCGCCACC
ACCCAGCGCGAACTTCTAATCTAAACCCTAACCCAGATATTCATCCGTATATAACTGCCC
GTCCATCCACAGAGATCCCATCATCGCCGCCGGAGCGGAGCTCAAGTTCCAGCCTCCTCC
ACCAAACCACCCAACCTATTACGGTCAGGGCTGAGAGATCTCGCAATTCGTTCGATTTTC
TTTCCGACCAGTTCTTTTTCATTCAGGTGATGGCAGTGACGATTTGCAAATATTCAAGCT
CAACAGACCAAATCACAGGTTTTCTCTCAGGAGTTGGTCTGTATGCCGATTATCCCGCTG
AACTGAGCCATCCGATTCCTGATTTTTCAATCTGCTGTTCATTGTTCTTTCCCCCGGATT
CGCGTCTGTCATGTTTGTTATTTTTGTTTTGTATTGGAGGACGTAGTTGCGATGAGGATA
ACAAGCTCCCTCTTCTGAAAGCATTGACGACATCGCTGGCAGAATCGAACCAATTAAATA
TTGCCACCACTGAGTAACTGTGTTGTACCCTCCAATTTTTCTTCACTTCTGATCTTCATT
TGCTTGTTCTGTACAAGATCTCTTTGGACCGTGAGGATTTACTGATGCATAATCCAACAC
TTGATCCGAGGCCGGCCTGTGCCGTCCATTGATGTCATCTTTGCATCTGAGTCCATCAGA
GATTAGTTTTTTTCTGTTTCATTTTTTTTGCTGATTTGCTCAGTATCAGGGGATGAAACC
ATGAAACAATCTTAGGACACCTTCTGACACAGTGCCTATTTTCCTGTGAATGAGAAGGCT
TTATATTCTGATGATACGCCTTAACTATTTTTCGATTTTTATCTGTCAATCTGCCTTCGG
CATTATATCTACAATGCAATTGACGCCTATGATGATTAGCTTTATGTTGGAATTACCGTC
TGATATCAAATGACGATATTTTTGCGGCTTTCTGAGGCTTAATACCACCAGCTTCTATAC
TGTTTGTAGTATGAAATCTCTCTTGTAGTATCAATTTCGTTTCTTAAATTGTCCCGGTGA
AGATTCTCAGACCATAGGAAGTGCCGTATGACACTGTAAACAACAGCTGGTTCTCTCCAC
TGCAAGTGTCCTCCGTTGACCATAGCCTTTGTGGTTTGGTCTATGCAGGAATCTCCATTT
GCAGCTGGTTTGAATCATCTGTGTGCGTGATTTTAAGCGGGTCTCTGAGGGATTTAGTTT
AATAGCATAAGTCAGCATTATTTGGTCAACTAGGGAGATAATATGGCAATGATGATAAAT
TTAAGGCTTGTTTCTCAAAACATTCGCAGATGCCGCCTAAGAGCTTTCGCCCTGCCAGGC
TTGAGAGCTAATGCTGCTAATTCCTTCCTTGGATGTCTGAGCCTTGTTAATATCCCAATA
TTTATACTGTTTTTGTTTTATTTTGTTGAATTTCATTGCATATTTCTTTGCATTGCAAAT
GATGATAAATTTAAGGCTTGTTTCTCAAACATTCGCAGTTGCCGCCTAAGAGCTTTCGCC
CTGCCAGGCTTGAGAGCTGATGCTGCTAGATCCTTCCTTGGATGTCTGATGCAATGCAAT
AGTTTAAACAATCTATCTTTTGTGCACTATGATATTTTCATTTGTATTATCTGTCTTGGT
TTGTGTTTGGCTTCCCTTTTGTTGTTATTGTTTGTGCGTGTAGAGATGTAGAAATTAATT
TCCTTTGTTTTGTCAATGTTGCTGCAGTTCTTTGTGAACTTACTGCAGGTTAGTAGTGGC
TTAACGACCTGAAGTTTTGCTTGGTTCCATTCCTAATTACCAATTAATAGTTTCACAGGG
GCTTTGTGAGGATCAGCACGAAAACGAAGGGAGGCTGATTGTGAAGAACTGGTGGCTTGG
GACCTTTGGCTCTGCATGTTTTTTTTTTTGGGTAATGCATGTGGGTTAATTTGCTATAAA
ATGTAACTGAGACCTGAAACTGTTGTTGGCCTGTGCTAGTTTCCTTATTAAAATCCTTGG
AAGTTCCCCTTAGATGTTGAATATGTTTTTTTCTTTTGCCCAACCAAGCATGTGTGGGTG
ATTGTATTGTGAAATCCCAAGTCAGAGAGACTTGTAAGTTCTCTATAATGCAACTAAGTG
AAGTACGATAATTAAAGGTTTCAAAAAATAACTAATTCAGATGAAAATTGTAAGTTCTCT
ATAATGCAACTAAGAAATAACAAATAATTAATTCAGATGAAGATTTAGCCTGAAGGCCAC
ACCCTTTGGTGTTGATAATTATTCTACTAGAGGGATTAATCCCTCTCACTTAATCTCTGT
TCGGTTAATACAATGACGGTTCTAAGTATACAGCAGCAGTATACAGCAGCGCATCAGCAC
CGCACGAGTAATACAAGTGTTTTCAATAGTGGAAGCAATTGGTCACAATTACAAGATGGA
ACAATCAGCAGATGGTGCTTGTAGGCTCGGCGCCGGAATTGGAAGTGAAGGGTCGTAGAG
GCATTGATGGTCCTTTGTTGCTGTTATCCCTTCTTCTCAAACATTGCCGCCGTCGCCGCC
ATGACATGAGAGAGGTCGAGGGAGGGAAATTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved